Define physical capacity tests for aerobic capacity, Biology

Assignment Help:

Define Physical Capacity Tests for Aerobic capacity?

Aerobic capacity has already been defined. Aerobic capacity is usually measured using a tread mill test in which the intensity of the exercise is progressively increased until maximum exertion levels are reached and at this point oxygen uptake is measured. Aerobic capacity is expressed as VO2 max, i.e. volume of oxygen in ml consumed per unit time at maximum exertion level. 


Related Discussions:- Define physical capacity tests for aerobic capacity

State about bone physiology, State about Bone physiology Bone physiolog...

State about Bone physiology Bone physiology that is most relevant to the study of mechanically mediated bone adaptation and its relevance in implant dentistry. These aspects in

Determine the way to verify the genotype of that animal, Some animals, such...

Some animals, such as cows, normally make only one offspring from each mating. If a cow showed a dominant phenotype, why would a typical testcross be a complex way to verify the ge

What is the approximate number of amino acids, What would be the approximat...

What would be the approximate number of amino acids of a protein with a mass of 203 kd? Assume an average molecular weight for amino acids of 110 grams/mol.

Explain hepatitis b, Hepatitis B  Vaccination against hepatitis B (Enger...

Hepatitis B  Vaccination against hepatitis B (Engerix-B - GlaxoSmithKline; Recombivax HB - Merck) is now a routine pediatric immunization in the US. It is recommended for previo

List the tissues of pancreas, Q. List the tissues of pancreas? The panc...

Q. List the tissues of pancreas? The pancreas is made up of two types of tissue: The exocrine tissue secretes digestive enzymes. These enzymes are secreted into a network of

Nutrients and the soil, Nutrients and the Soil Early experiments on mi...

Nutrients and the Soil Early experiments on mineral uptake were performed by Hoagland, Stout and Amon in 1923. They showed that minerals were taken up from the soil primarily

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Closed mitral valvotomy-mitral valve disease, Closed Mitral Valvoto...

Closed Mitral Valvotomy :  This has been 1-eplaced by balloon mitral valvotomy (BMV) in most centres. It is done in cases of either pure mitral stenosis or with .triv

What are the destinations of those oxygen atoms, Photosynthesis is the most...

Photosynthesis is the most significant producer of molecular oxygen (O2) on our planet. From which molecule do oxygen atoms liberated by photosynthesis come? From which other molec

Population parameters and regulation, Population Parameters and Regulation ...

Population Parameters and Regulation Population can be defined as a group of organisms of same species occupying a specific area at a particular time, such as all the deer or

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd