Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Eucaryotic Cell Organelles
A eucaryotic cell has excessive foldings of intrace!:u:;ir cembrane as compared to procaryotic cell. The eucaryotic cell has a number of'organelles such as endoplasmic reticulum, Golgi apparatus, nucleus, mitochondria etc. Organelles have the same relation to a cell, as organs have with an organism. The endoplasmic reticulum is a complex system of membranous sacs, chambers, and tubular canals. It is the site for synthesis of proteins. The Golgi apparatus (or complex) which is a stack of flattened sacs sorts out and processes proteins, besides, it helps in secretion. Membranes also enclose lysosomes, the organelles that contain enzymes necessary for degrading foreign materials thereby help in defence mechanisms. Likewise, membranes surround peroxisomes (microbodies) in which highly reactive hydrogen peroxide is synthesised and degraded. Peroxisomes are also the sites where a variety of biochemical reactions cause conversion of lipids into proteins and v+~ ,e-aversa. In plants, the membranes surround large liquid filled vacuoles. The remaining cytoplasm which is not bound by these organelles is referred to as the cytosol.
The extensive intracellular membrane system of a eucaryotic cell is much larger in size than a procaryotic cell. It provides enough surface area for the exchange of materials and other important cellular reactions which take place on the membrane surface.
It is assumed that membranous organelles have been formed by infolding of plasma membrane through a process called endocytosis (Figure shown below). In endocytosis portions of cell membrane along with the contents of the external medium invaginate and pinch off in the form of cytoplasmic vesicles. Exocytosis is just a reverse process.
What is the classification of protozoa with examples
Q. Meaning of Counselling in diabetes mellitus? The word counselling is a very broad term which is used for helping others to overcome their particular difficulty. It has been
Origin and Evolution of Metazoa Most of the early metazoans were soft bodied and so their fossils are rare. The extremely fragmented fossil record does not shed any specific l
Q. Why is a leguminous crop rotation used in agriculture? The Leguminous crop rotation and other crop rotations are used in agriculture for the reason that in these plants many
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the Marasmus - protein energy malnutrition? Marasmus, the other end of the same spectrum as kwashiorkor, is common in children below the age of 2 years. The characteris
Q. What are the modes of transmission, main signs and symptoms and treatments of hepatitis B? The Hepatitis B is a disease caused by a DNA virus. The transmission is by blood (
When comparing the DNA of a calfs liver and thymus, which would be predicted to have more DNA and why? What are the differences of the DNA between the two?
Explain Metabolism of Iron? In this sub-section, we will study how body gets its iron supply, how iron is transported and utilized by the various tissues and how iron balance i
Explain the Storage of Vitamin E? Vitamin E is mainly stored in muscles and adipose tissue. Vitamin E content of erythrocytes is about 20 percent of that in plasma and there i
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd