Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
How does a DNA vaccine prevent future disease?
A DNA vaccine having DNA from a pathogen but cannot cause disease. When the vaccine is injected into a patient, the DNA directs the synthesis of a protein. Antibodies are formed by the body against the protein. If the patient contracts the disease in the future, the antibodies in his or her body will be able to give protection.
Define Isotope Dilution Method? The measurement of total body water (TBW) is based on the principle of hydrometry. You must be aware that water is the most abundant substance i
Q. What is the etiological agent of visceral leishmaniasis? How the disease transmitted and what is are its typical manifestations? The Visceral leishmaniasis is caused by the
Define the meaning of Open Kettles? A number of foods can be satisfactorily concentrated in open kettles which are heated by steam. This is the case for jellies and jams, toma
What is Choanoflagellate? Explain in brief. The protozoans which resemble the choanocyte cells found in sponges. They have a collar of microvilli which surround a central flage
An enhance in parasympathetic discharge to the heart leads to A. An enhance in the conductance of F-channels in SA node cells. B. An enhance in the conductance of potassium
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Understanding Behaviour of diabetic patients? Beliefs Each of us has a set of beliefs that were learned by us when we were young. These include religious beliefs and
Ethidium Bromide intercalates within structure of the nucleic acids in such a manner that they fluoresce under the UV light. Ethidium bromide staining is generally used to visuali
Why is an S strain of bacteria able to cause disease in mammals but a R strain is not? The slippery capsule stops the cells of the defence system from capturing and destroying
Q. What is the function of platelets? What consequences does the clinical condition known as thrombocytopenia yield? Platelets, also known as thrombocytes are fragments of gian
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd