Human impact on the phosphorus cycle, Biology

Assignment Help:

Human Impact on the Phosphorus Cycle

Like other biogeochemical cycles, human activities have altered the phosphorus cycle. Human beings mine phosphate rocks and guano deposits to make phosphorus available for production of fertilisers, detergents, animal feed, medicines, pesticide: and numerous other products. This mining exposes phosphate deposits made over millions of years. Phosphates are removed from soil through cropping of vegetation and to replace it phosphate fertilisers have to be added. Because of the abundance of calcium, iron and aluminium in the soil much of the phosphates get immobilised as insoluble salts. Thus more fertilisers have to be added. This results in high concentration of phosphates in agricultural runoffs. Similarly concentration of phosphorus in detergents, wastes of food processing plants, animal feed lot, sewage, etc., add to a considerable quantity of phosphorus poured in natural waters.

This problem becomes acute in urban areas. As said earlier, in aquatic ecosystems the phosphorus is taken up rapidly by the vegetation resulting in a sudden explosive growth of algae. Like nitrogen, this leads to cultural eutrophication of the water body. The producers cloud the water and forms a scum on the surface, blocking sunlight for the submerged plants. This is one example of the result of accumulation of nutrients at one stage of the nutrient cycle. It is important to note that the means of returning phosphorus to the cycle are inadequate to compensate for the loss. Sea birds have traditionally played-an important part in returning phosphorus to the cycle via their droppings (for example guano deposits off the coast of Peru) but apparently not at the rate at which it has occurred in the past. Unfortunately human activities appear to hasten the rate at which phosphorus is lost and thus make the cycle 'less perfect'. You could think our present use of phosphorus which is washed out into the rivers and finally into the oceans as an accelerated 'pouring' of phosphorus from the source to the sink.


Related Discussions:- Human impact on the phosphorus cycle

Trichomonas vaginalis - protozoan, Trichomonas vaginalis - Protozoan T...

Trichomonas vaginalis - Protozoan This cosmopolitan protozoan lives exclusively in the female vagina and male urethra or prostate. It causes a mild disease called trichomonas

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Essentiality of phosphorus for growth of microorganism, Define Essentiality...

Define Essentiality of Phosphorus for Growth of Micro-Organism Phosphorus is used in the form of phosphate salt by microorganisms. It is involved in formation of nucleic acids,

Reproductive cycle - human development, Reproductive Cycle The whole r...

Reproductive Cycle The whole reproductive cycle consists of an ovarian cycle and a uterine cycle. Figure illustrates one complete reproductive cycle. You can observe in the fi

Biology in dispelling myths and misbeliefs, BIOLOGY IN DISPELLING MYTHS AND...

BIOLOGY IN DISPELLING MYTHS AND MISBELIEFS - Varieties of myths still exist in our society, and can be removed by the knowledge of Biology. Some of these are- 1.       Snake

Explain the confirmed test - most probable number test, Explain the Confirm...

Explain the Confirmed Test - Most Probable Number Test? Confirmed test is carried out to rule out the possibility of any positive presumptive test because of the presence of no

Describe why the bile acids are much better suited, All of the following il...

All of the following illustrate why the bile acids are much better suited then cholesterol for use as emulsification agents for fats except: -cholesterol contains a hydroxyl gro

State in detail about rocks, State in detail about rocks A mass of mine...

State in detail about rocks A mass of mineral matter is called  rock. It may be composed of one or more minerals.  Some rocks are hard and compact e.g. granite and basalt, whil

Theoretical foundation of halsted reitan battery, Theoretical Foundation of...

Theoretical Foundation of Halsted Reitan battery There are really two theoretical bases for the Halsted Reitan battery, one contained in brain and intelligence and related writ

Experiment to test your hypothesis, Deinococcus radiodurans is a bacterium ...

Deinococcus radiodurans is a bacterium that was isolated from cooling ponds in and around nuclear power plants. It is highly resistant to ionizing radiation. Propose an hypothesis

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd