How drug intolerance in tuberculosis, Biology

Assignment Help:

Drug Intolerance

For patients who cannot tolerate rifampin, alternative regimens include 9-12 months of isoniazid, ethambutol and pyrazinamide, with or without a fluoroquinolone (usually levofloxacin, moxifloxacin,  or gatifloxacin); 18 months of isoniazid plus ethambutol has also been given. Rifabutin has been substituted for rifampin in standard regimens for some patients who could not take rifampin because of drug interactions. Patients who cannot take pyrazinamide in the initital phase of treatment should receive continuation therapy with isoniazid and rifampin for a total of 7 months.

 


Related Discussions:- How drug intolerance in tuberculosis

The best absorbed in an acidic environment, Why is a weekly acidic drug bes...

Why is a weekly acidic drug best absorbed in an acidic environment?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Antimicrobial barriers - proliferation of microorganisms, Q. Antimicrobial...

Q. Antimicrobial Barriers -  proliferation of microorganisms? The first barrier is the integument: a physical barrier to protect the food, e.g., the shell on eggs, the skin on

Which functional group ionization is stabilized by resonance, In which of t...

In which of the following functional groups ionization is stabilized by resonance? Select one: a. Carboxyl b. Hydroxyl c. Amine d. Aldehyde e. All of the above

Types of eggs, TYPES OF EGGS Different species of animal has different ...

TYPES OF EGGS Different species of animal has different type of eggs. They are classified on the following basis - 1 .         ON THE BASIS OF AMOUNT OF YOLK On the ba

Ecology.., write the charecteristics of lake ecosystem

write the charecteristics of lake ecosystem

Pancreas and its structure, PANCREA S - It is derived from the endoder...

PANCREA S - It is derived from the endoderm of the embryo. Structure . The pancreas lies inferior to the stomach in a bend of the duodenum. It is both an exocrine an

Define absorption, Define Absorption, Storage and Elimination of Pyridoxine...

Define Absorption, Storage and Elimination of Pyridoxine? Pyridoxine, pyridoxal and pyridoxamine (along with their phosphorylated forms) occur in plant and animal foods. The ph

Human reproduction, Why is the human placenta referred to as haemochorial t...

Why is the human placenta referred to as haemochorial type? Name the hormone it secretes to facilitate parturition.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd