Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Drug Intolerance
For patients who cannot tolerate rifampin, alternative regimens include 9-12 months of isoniazid, ethambutol and pyrazinamide, with or without a fluoroquinolone (usually levofloxacin, moxifloxacin, or gatifloxacin); 18 months of isoniazid plus ethambutol has also been given. Rifabutin has been substituted for rifampin in standard regimens for some patients who could not take rifampin because of drug interactions. Patients who cannot take pyrazinamide in the initital phase of treatment should receive continuation therapy with isoniazid and rifampin for a total of 7 months.
Why is a weekly acidic drug best absorbed in an acidic environment?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Antimicrobial Barriers - proliferation of microorganisms? The first barrier is the integument: a physical barrier to protect the food, e.g., the shell on eggs, the skin on
In which of the following functional groups ionization is stabilized by resonance? Select one: a. Carboxyl b. Hydroxyl c. Amine d. Aldehyde e. All of the above
TYPES OF EGGS Different species of animal has different type of eggs. They are classified on the following basis - 1 . ON THE BASIS OF AMOUNT OF YOLK On the ba
what is the latest classification of fungi
write the charecteristics of lake ecosystem
PANCREA S - It is derived from the endoderm of the embryo. Structure . The pancreas lies inferior to the stomach in a bend of the duodenum. It is both an exocrine an
Define Absorption, Storage and Elimination of Pyridoxine? Pyridoxine, pyridoxal and pyridoxamine (along with their phosphorylated forms) occur in plant and animal foods. The ph
Why is the human placenta referred to as haemochorial type? Name the hormone it secretes to facilitate parturition.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd