Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the De Bakey Type I Dissection?
De Bakey Type I Dissection : Initial steps of the operation are same as previously described. Provision for deep hypothermic circulatory arrest made along with retrograde cerebral perfusion. Depending on the site of tear the graft is anastomosed to the descending aorta or to the under aspect of arch or just proximal to innominate artery after cooling to 20" C and achieving circulatory arrest and retrograde cerebral perfusion. Then pump is restarted and de-airing through the graft done and re-warming started.
Q. What are neoplasias? The Neoplasia is any abnormal and uncontrolled proliferation of cells of an organism. The Neoplasias can be benign or malign and benign neoplasias are t
The fusion of two individuals with each acting as a gamete is known as
Explain function of lymph nodes? Lymph nodes have white blood cells which ingest bacteria and prevent them from reaching the circulation.
Q. What is Pre-requisites of counselling? Pre-requisites of counselling are: 1. Facilities for counselling to be available for the patient near home or working place. 2.
Define precaution for estimation of vitamin c in lemon juice? 1. Rinse all glassware with 3% metaphosphoric acid before you begin your practical and subsequently each time you
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Water is widely used in various process applications in industry. Other major industrial uses are boiler feed water and cooling water. The king and degree of treatment of water in
What is digestion? Digestion is the breaking down of larger organic molecules obtained from the diet, e.g. carbohydrates, fats, proteins, into smaller ones, as glucose, fatty a
Organisms are made to compete for their needs from the environment. The competition as we pointed earlier could be for the food and territory, to overcome the adverse climatic cond
Similarities in body parts often indicate shared ancestry. Which of the following is true? Structures used for different purposes in different groups can be controlled by the same
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd