Explain the de bakey type i dissection, Biology

Assignment Help:

Explain the De Bakey Type I Dissection?

De Bakey Type I Dissection :  Initial steps of the operation are same as previously described. Provision for deep hypothermic circulatory arrest made along with retrograde cerebral perfusion. Depending on the site of tear the graft is anastomosed to the descending aorta or to the under aspect of arch or just proximal to innominate artery after cooling to 20" C and achieving circulatory arrest and retrograde cerebral perfusion. Then pump is restarted and de-airing through the graft done and re-warming started.

 


Related Discussions:- Explain the de bakey type i dissection

What are neoplasias, Q. What are neoplasias? The Neoplasia is any abnor...

Q. What are neoplasias? The Neoplasia is any abnormal and uncontrolled proliferation of cells of an organism. The Neoplasias can be benign or malign and benign neoplasias are t

Reproduction, The fusion of two individuals with each acting as a gamete is...

The fusion of two individuals with each acting as a gamete is known as

What is the function of lymph nodes, Explain function of lymph nodes? L...

Explain function of lymph nodes? Lymph nodes have white blood cells which ingest bacteria and prevent them from reaching the circulation.

What is pre-requisites of counselling, Q. What is Pre-requisites of counsel...

Q. What is Pre-requisites of counselling? Pre-requisites of counselling are: 1. Facilities for counselling to be available for the patient near home or working place. 2.

Define precaution for estimation of vitamin c in lemon juice, Define precau...

Define precaution for estimation of vitamin c in lemon juice? 1. Rinse all glassware with 3% metaphosphoric acid before you begin your practical and subsequently each time you

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Treatment of water for industrial use, Water is widely used in various proc...

Water is widely used in various process applications in industry. Other major industrial uses are boiler feed water and cooling water. The king and degree of treatment of water in

What is digestion, What is digestion? Digestion is the breaking down of...

What is digestion? Digestion is the breaking down of larger organic molecules obtained from the diet, e.g. carbohydrates, fats, proteins, into smaller ones, as glucose, fatty a

Factors that limit the reproductive potential, Organisms are made to compet...

Organisms are made to compete for their needs from the environment. The competition as we pointed earlier could be for the food and territory, to overcome the adverse climatic cond

Why similarities in body parts often indicate shared, Similarities in body ...

Similarities in body parts often indicate shared ancestry. Which of the following is true? Structures used for different purposes in different groups can be controlled by the same

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd