Explain karyotype - animal taxonomy, Biology

Assignment Help:

Explain Karyotype - Animal Taxonomy?

In animals systematic, it is the karyotype, that is the chromosome number and structure which are used quite extensively either separately or both together.

chromosome number as you know is quite constant within a species, though it may vary from one species to another even within the same genera. Among animals the chromosome number ranges from a diploid of 2 in Parascaris  equorum vat univalins to 446 in the lycaenid butterfly (Lysandra  arlantica). However, in most animals it is between 12-60 chromosomes.

1914_Karyotype.png

figure: The phylogeny of Trichopternn families plotted on of chrmmme numbers (FhKiauia. 1%7).

Generally, the chromosome number is not enough for identifying organisms, though in some it has proved to be quite useful, as for example in the marsupial family Didelphidae (opossums) where species of genus (Monodelphis have a diploid number of 18 chromosomes and those of genus Didelphis have a diploid number of 22 chromosomes.

Similarly in the order of Trichoptera, the chromosome number alone has been used to plot the phylogenetic relationships among the various families as you can see in Figure.


Related Discussions:- Explain karyotype - animal taxonomy

How many progeny flies have vestigial wings, In the fruit fly Drosophila, a...

In the fruit fly Drosophila, a rudimentary wing called "vestigial" and dark body color called "ebony" are inherited at independent loci and are recessive to their dominant wild-typ

Chlamydiosis-epidemiology, Epidemiology The organism does not appear t...

Epidemiology The organism does not appear to be very host or tissue specific and can infect naturally a large number of avian and mammalian species. Chlamydiosis has been reco

What is tertiary structure of a protein, Q. What is tertiary structure of a...

Q. What is tertiary structure of a protein? What are the major types of tertiary structure? The tertiary protein structure is a spatial conformation additional to the secondary

Causes of oesophagitis, Q. Causes of oesophagitis? The causes include t...

Q. Causes of oesophagitis? The causes include tissue erosion by hydrocliloric acid (EIC1) and pepsin, with symptoms of substernal burning, cramping, pressure sensation or sever

Agro-industrial -cereal and gram by-products, Cereal and Gram By-Products ...

Cereal and Gram By-Products Agro-processing is now regarded as the sun rise sector in view of its large potential in maintaining the nutritional quality of processed feed resource

Problem areas in integrative and environmental biology, Q Identify truly ex...

Q Identify truly exciting problem areas in integrative and environmental biology that need an integrated approach utilizing mathematics and statistics. What questions absolutely n

What are the two techniques of submerged implants, Submerged implants Decis...

Submerged implants Decision has to be made between two techniques. These techniques are: Technique 1: Stage two using a mucoperiosteal flap Technique 2: Stage two done wi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd