Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Karyotype - Animal Taxonomy?
In animals systematic, it is the karyotype, that is the chromosome number and structure which are used quite extensively either separately or both together.
chromosome number as you know is quite constant within a species, though it may vary from one species to another even within the same genera. Among animals the chromosome number ranges from a diploid of 2 in Parascaris equorum vat univalins to 446 in the lycaenid butterfly (Lysandra arlantica). However, in most animals it is between 12-60 chromosomes.
figure: The phylogeny of Trichopternn families plotted on of chrmmme numbers (FhKiauia. 1%7).
Generally, the chromosome number is not enough for identifying organisms, though in some it has proved to be quite useful, as for example in the marsupial family Didelphidae (opossums) where species of genus (Monodelphis have a diploid number of 18 chromosomes and those of genus Didelphis have a diploid number of 22 chromosomes.
Similarly in the order of Trichoptera, the chromosome number alone has been used to plot the phylogenetic relationships among the various families as you can see in Figure.
In the fruit fly Drosophila, a rudimentary wing called "vestigial" and dark body color called "ebony" are inherited at independent loci and are recessive to their dominant wild-typ
Epidemiology The organism does not appear to be very host or tissue specific and can infect naturally a large number of avian and mammalian species. Chlamydiosis has been reco
Q. What is tertiary structure of a protein? What are the major types of tertiary structure? The tertiary protein structure is a spatial conformation additional to the secondary
Q. Causes of oesophagitis? The causes include tissue erosion by hydrocliloric acid (EIC1) and pepsin, with symptoms of substernal burning, cramping, pressure sensation or sever
Cereal and Gram By-Products Agro-processing is now regarded as the sun rise sector in view of its large potential in maintaining the nutritional quality of processed feed resource
Q Identify truly exciting problem areas in integrative and environmental biology that need an integrated approach utilizing mathematics and statistics. What questions absolutely n
NatURAL SELECTION IN BIOLOGY
Submerged implants Decision has to be made between two techniques. These techniques are: Technique 1: Stage two using a mucoperiosteal flap Technique 2: Stage two done wi
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is sporopollinin?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd