Explain binding of pigments - proteins, Biology

Assignment Help:

Binding of  Pigments, synthetic dye

In  addition  to water, lipids and  volatile  flavours,  food proteins  can  bind  a number of other  substances  by  weak interactions  or  by covalent bonds,  depending  upon  their chemical  structure.

Eg. Pigments, synthetic dyes (which may be used for analytical determination of proteins) and substances with mutagenic, sensitizing biological activity.

Such binding may result both in increased toxicity or detoxification and in some cases; the nutritional values can be adversely affected.

 


Related Discussions:- Explain binding of pigments - proteins

What is relationship cph in photon and frequency of photon, what is relatio...

what is relationship between numbers CPH in photon and frequency of photon? Answer; the photon contains n CPH and its energy is E=hν, when photons energy increases that the num

What are pleura, What are pleura, pericardium and peritoneum? Pleura ar...

What are pleura, pericardium and peritoneum? Pleura are the membrane that hides the lungs and the inner wall of the chest; pericardium is the membrane that hides the heart; per

Define about skeletal muscle, Define about skeletal muscle? A. The bind...

Define about skeletal muscle? A. The binding of calcium ion to a binding site on the troponin molecule leads to a movement of the tropomyosin molecule that, in turn, exposes a

Steps of initiation , The entire mechanism of protein synthesis i...

The entire mechanism of protein synthesis in eukaryotes is generally the same as in prokaryotes, with three phases explained as termination, elongation and initiation. Furthermore,

What is organelles, What is Organelles? Organelles :   Eukaryotic cel...

What is Organelles? Organelles :   Eukaryotic cells contain various membrane-bound structures called organelles, in contrast to prokaryotes, which lack a definite internal or

State normal physiological saline, A complete motor neuron is deleted from ...

A complete motor neuron is deleted from a frog and placed in a large volume of normal physiological saline.  The neuron is healthy; it has a stable resting voltage of -70 mill

Can you explain cholera, Q. Can you explain Cholera? Cholera is one of ...

Q. Can you explain Cholera? Cholera is one of the diseases which had caused epidemics all over the world. The organism which causes the disease is Vibrio cholerae. It is an

Valve replacement, Valve Replacement Replacement of the diseased valve...

Valve Replacement Replacement of the diseased valve is done. This is done biologic tissue valves or mechanical valves. Three types of biologic tissue valves are used. Aut

Find the genotypes and phenotypes of the f1, Determine the genotypes and ph...

Determine the genotypes and phenotypes of the F1 generation from a colour blind father and a mother who is homozygous for normal colour vision.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd