Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Binding of Pigments, synthetic dye
In addition to water, lipids and volatile flavours, food proteins can bind a number of other substances by weak interactions or by covalent bonds, depending upon their chemical structure.
Eg. Pigments, synthetic dyes (which may be used for analytical determination of proteins) and substances with mutagenic, sensitizing biological activity.
Such binding may result both in increased toxicity or detoxification and in some cases; the nutritional values can be adversely affected.
what is relationship between numbers CPH in photon and frequency of photon? Answer; the photon contains n CPH and its energy is E=hν, when photons energy increases that the num
What are pleura, pericardium and peritoneum? Pleura are the membrane that hides the lungs and the inner wall of the chest; pericardium is the membrane that hides the heart; per
Define about skeletal muscle? A. The binding of calcium ion to a binding site on the troponin molecule leads to a movement of the tropomyosin molecule that, in turn, exposes a
The entire mechanism of protein synthesis in eukaryotes is generally the same as in prokaryotes, with three phases explained as termination, elongation and initiation. Furthermore,
What is Organelles? Organelles : Eukaryotic cells contain various membrane-bound structures called organelles, in contrast to prokaryotes, which lack a definite internal or
A complete motor neuron is deleted from a frog and placed in a large volume of normal physiological saline. The neuron is healthy; it has a stable resting voltage of -70 mill
Q. Can you explain Cholera? Cholera is one of the diseases which had caused epidemics all over the world. The organism which causes the disease is Vibrio cholerae. It is an
Valve Replacement Replacement of the diseased valve is done. This is done biologic tissue valves or mechanical valves. Three types of biologic tissue valves are used. Aut
Determine the genotypes and phenotypes of the F1 generation from a colour blind father and a mother who is homozygous for normal colour vision.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd