Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Isoniazid
Serum aminotransferase activity increases in 10% to 20% of patients taking isoniazid, especially in the early weeks of treatment, but often returns to normal even when the drug is continued. Severe liver damage due to isoniazid is less common than previously thought. It is more likely to occur in patients more than 35 years old, but can also occur in younger patients. Routine monitoring is not necessary except for patients with pre-existing liver disease. Medical Letter consultants recommend stopping isoniazid when serum aspartate amino transferase activity reaches five times the upper limit of normal or if the patient has symptoms of hepatitis, but it can sometimes be re-started later.
Peripheral neuropathy occurs rarely and can usually be prevented by supplementation with pyridoxine (Vitamin B6, 10-25 mg/day), which is recommended for patients with chronic alcohol use, diabetes, chronic renal failure or HIV infection, and for those who are pregnant, breast feeding or malnourished.
CONDUCTIO N OF IMPULSE - IN NON-MYELINATED AXONS - The impulse moves along the axon as local effect by altering the permeability of neighbouring Na + channels and af
Q What is the genetic material of a virus? How does that material act in viral reproduction? There is DNA viruses double strand or single strand DNA and RNA viruses double stra
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
why are life forms significant?
What organic molecules make up the cell membrane?
What is the excretory organ of an agama lizard?
Phylum Myxornycetes 1) They are known as cellular slime moulds mostly grow in damp places e.g. soil and rotting tree trunks. 2) They have a curious life-cycle in which free
The cranial nerves are composed of twelve pairs of nerves which emanate from the nervous tissue of brain. In order to reach their targets they should ultimately exit/enter the cr
Who is Aristotle - the Stagirite? The ptodigious activity of Aristotle (384-323 B.C.) marks the climax of the Golden Age of Greece. The very existence of his works proves not s
What is the evolutionary advantage of the occurrence of sperm cells and larval stage in the life cycle of sponges? The sexual reproduction in sponges, in addition to contributi
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd