What is schistosomiasis, Biology

Assignment Help:

Q. What is schistosomiasis?

The Schistosomiasis is a worm infection caused by schistosomes, a species of flatworms (platyhelminthes). The disease is common in Latin America and in the Far East. The major species of schistosome found in Latin America is Schistosoma mansoni.


Related Discussions:- What is schistosomiasis

What proportion of progeny pairs gt or ac have, A haploid cross is made in ...

A haploid cross is made in which the mutant allele has GC at base position 200 in the DNA of a certain gene, and the wild type has AT. What proportion of progeny will have the hybr

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is polyembryony, What is polyembryony? Polyembryony is the phenome...

What is polyembryony? Polyembryony is the phenomenon in which a single embryo in its initial embryonic stage separates itself forming many new individuals of the similar sex an

Explain diagnosis of root perforation, Explain Diagnosis of Root Perforatio...

Explain Diagnosis of Root Perforation 1- Exploration: Continuous bleeding if the defect touched during cleaning and shaping lead to difficult vision. Difficult to d

Rare species - wildlife, Rare Species - Wildlife These are those speci...

Rare Species - Wildlife These are those species whose numbers are few or they live in such small areas or in such unusual environments (endemics), that they could quickly disa

What do you mean by gametogenesis, Q. What is the kind of cell division tha...

Q. What is the kind of cell division that allows sexual reproduction? What is gametogenesis? Meiosis is the kind of cell division that permits sexual reproduction since it redu

Explain about colloidal system, Explain about colloidal system A colloi...

Explain about colloidal system A colloidal system, on the other hand, is a heterogeneous system. The material that forms the base of the system is called  the dispersion medium

Explain the process of nucleotide catabolism, Question 1 Write a short not...

Question 1 Write a short note on the following Free Energy Cori cycle Fermentation Pentose phosphate pathway Transamination Allosteric Regulation Qu

Difference between spermatocyte i and spermatogonium, Q. What is the differ...

Q. What is the difference between spermatocyte I and spermatogonium? The male germ cells are the spermatogonia (diploid cells, 2n) situated in the testicles and they mature an

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd