Explain about the high risk pregnancies, Biology

Assignment Help:

Explain About the High Risk Pregnancies?

Until now we have considered the nutritional needs of pregnant women. In this sub-section, we will consider specific conditions that contribute to high-risk pregnancies.  Health care professionals favour health promotion with a preventive approach. Various factors have been identified which are associated with high risk. They are summarized in the Table. Some of these, you will realize cannot be changed as in case of personal characteristics and some can be changed, some are preventable and others can be controlled.

1910_High Risk Pregnancies.png

Some problems are directly related to the pregnancy itself such as anaemia, hyper emesis gravidarum (extreme form of morning sickness) or pregnancy-induced hypertension.  For some, the normal physiological stress imposes demands on a relatively poor maternal nutritional status or maternal reserves that are not sufficient to meet the new additional needs. Pre-existing diseases such as diabetes, chronic hypertension or phenylketonuria also pose risks. Hence, it is important to pay attention to such mothers. Adequate nutrition and consistent prenatal care can reduce the risk of premature delivery or low birth weight babies. High-risk pregnancies need special management including intervention to correct malnutrition.


Related Discussions:- Explain about the high risk pregnancies

Open and closed type of circulatory systems, Open and Closed Type of Circul...

Open and Closed Type of Circulatory Systems There are two categories of circulatory system found in higher metazoans. In one type the original blastocoel carries on to be the

Define the concept of health - public nutrition, Define the Concept of Heal...

Define the Concept of Health - Public Nutrition? The most widely accepted definition of health is the one given by WHO (1948) in the preamble to its constitution, Box 1 gives t

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Express the genotype and phenotype of the male, 1. In rabbits, black fur is...

1. In rabbits, black fur is dominant to brown, and long hair is dominant to short hair. A male is mated to several brown, short-haired females. These matings result in the followin

Wbc.., Ask question #Minimuwwm 100 words accepted#

Ask question #Minimuwwm 100 words accepted#

How are animals divided according to their digestive process, Q. How are an...

Q. How are animals divided according to their kind of digestive process? At a distance from sponges that do not have a digestive cavity where extracellular digestion takes plac

Class turbellaria, plz answer me how I arrange my topic with its order ?

plz answer me how I arrange my topic with its order ?

What is the respective importance of water, What is the respective importan...

What is the respective importance of water, carbon and nitrogen for living beings? Water is the major solvent of living beings and it is essential practically for all biochemic

Demographic transition, Demographic Transition As we saw earlier, deat...

Demographic Transition As we saw earlier, death rates and birth rates have been nearly equal throughout much of human history. However, in Western Europe, death rates began to

Define glycogenolysis, Define Glycogenolysis Glycogenolysis : degrad...

Define Glycogenolysis Glycogenolysis : degradation of glycogen.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd