Explain selective breeding methods, Biology

Assignment Help:

Explains how selective breeding methods could be used to produce a population of cats with the short legs.

Selective breeding

  • E1: bases explanation on the assumption that the mutated allele is dominant.
  • E2: breed short-legged offspring together or with mother.
  • E3: any short-legged offspring will be either heterozygous or homozygous dominant.
  • E4: to find out what they are, carry out a test cross ie breed with another normal cat (homozygous recessive).
  • E5: if no normal size legs offspring occur (after multiple breedings), then it can be taken that the tested individual is homozygous for short legs. This cat can be used for future breeding. / Any cat that produces offspring with normal legs is heterozygous and shouldn't be used for future breeding.

 


Related Discussions:- Explain selective breeding methods

State the designations for horizons, State the Designations for Horizons  ...

State the Designations for Horizons  Of the several horizons, the master horizons are the results of the fundamental soil forming processes, viz. humification, eluviation  and

Entamoeba histolytica, Entamoeba Histolytica Losch (1875), for the fir...

Entamoeba Histolytica Losch (1875), for the first time, described the disease symptoms of infection of Entamoeba histolytica. However, it was only in 1903 that Schaudin gave t

Explain trifluridine, Explain Trifluridine  (Viroptic)  Trifluridine is...

Explain Trifluridine  (Viroptic)  Trifluridine is a nucleoside analog active against herpes viruses, including acyclovir-resistant strains. Marketed in an ophthalmic preparatio

How can we increase of total peripheral resistance, How can we increase of ...

How can we increase of total peripheral resistance?   A.  A decrease in the diameter of every arteriole.   B.  An increase of sympathetic discharge to all the smooth muscles

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is gene expression, What is Gene Expression ? Gene expression i...

What is Gene Expression ? Gene expression is the process by which a gene is activated to produce a certain protein. Cells are able to respond to changes in the environment i

Describe binding of two amino acid for peptide formation, How can the bindi...

How can the binding of two amino acids for the peptide formation be described? A peptide is formed when a carbon from the carboxyl group of one amino acid is linked to the nitr

Prevention and control of staphylococcal food poisoning, Q. Prevention and ...

Q. Prevention and Control of Staphylococcal food poisoning? Staphylococcal food poisoning can be prevented by: 1. Avoiding contamination of food with S. aureus. 2. Prev

Define type of chemical reaction used in volumetric analysis, Define the Ty...

Define the Type of chemical reaction used in volumetric analysis? The titration has to be based on some rapid chemical reaction. Although any type of chemical reactions may be

Show some examples of migratory animals, Q. What are some examples of migra...

Q. What are some examples of migratory animals? Instance of the migratory animals are southern right whales from Antarctica, that procreate on the Brazilian coast; the migrator

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd