Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is the other name given to sex chromosomes?
Sex chromosomes are also known as allosomes (the other chromosomes that are not sex chromosomes are known as autosomes).
Elaborates Class Trematoda and Monogenea - Flukes? Members of this Class are commonly known as the tapeworms. They resemble a long flat tape, or ribbon, and are parasitic, livi
Define Requirements and Recommended Dietary Allowances (RDA)? What do we mean by requirements and RDA? The requirement level is the amount of nutrient needed to be absorbed to
Q. What is AV Block ? First Degree AV Block At rest commonly disappears with exercise owing to the vagal withdrawal. The development of a prolonged PQ segment after exerc
Q. How do the muscles of the legs and of the feet contribute to the venous return? The muscles of the legs mainly the muscles of the calves compress and contract the deep veins
Is there a exchange of cells between the mother and the fetus through the placenta? Under normal conditions, there is not a passage of cells across the placenta during gestati
In what order did the four phyla of protazoa evolve and why in this order?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Determine the parts of plant source The natural food colourants from plant sources are classified into 5 types: a) Anthocyanins, b) Betalaines, c) Carotenoids, d) C
Phylum Ciliophora 1) They have cilia at some stage in the life-cycle. The cilia are used for locomotion or creating a feeding current. 2) They feed heterotrophically usually
THYROI D DISORDERS - (A ) Hyperthyroidism (Hypersecretion of thyroid hormone). Graves' disease or Basedow's disease or Parry's disease or exophthalmic goitre . It is a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd