Delimitation and limitation, Biology

Assignment Help:

Delimitation and Limitation:

There may  be many  aspects of the problem that need  to be  explored, but  it  is difficult to  cover all aspects in  a single research study because of Limited  time, finance, facilities and other  reasons. Delimitations indicate the  cut off points beyond which the researcher does not  intend  to probe. 'It includes  those restrictions that the researcher placed  on  the  study prior to  gathering data. Refer to  the example of pre-operative teaching of breathing exercises where only adult of 20 to  55 years of age participated in the study. This means that  any patient with less  than 20  or more than  55 years was not included  in  the sample. Hence, one of the delimitations was  age i.e.  "the  study was  limited  to  adult patients between  the  age of 20  to 55 years. "Delimitations are considered at every decision point during planning stage of  the study.  

The  limitations  indicate the weaknesses of  the entire study, as the  researcher perceives them. The reader  looks for  the  shortcomings for two  reasons; one, to identify whether the researcher has recognized the  flaws; second to  know  the difficulties the  researcher has faced which  are valuable for  future researcher. Some of  the common examples of  limitations are "the  reliability; the instrument developed was not  satisfactory; "subject--mortality", i.e.  some of the  sample subjects who took  the pretest were not available for post-test, "content of  the data  indicate subjective bias". 

Therefore the  delimitations are set during the planning stage whereas the limitations are experienced during implementation stage and these uncontrollable elements are reported  in  the third stage of research process  i.e. while writing.  

 


Related Discussions:- Delimitation and limitation

Respiration, lesson plan practical requirements

lesson plan practical requirements

Fungal diseases - aspergillosis, F u n g a l diseases A spergill...

F u n g a l diseases A spergillosis Aspergillosis is mycotic disease of poultry and all other species of birds caused by a fungus known as Aspergillus fumigatus . F

Ingestion of foreign bodies, Ingestion of Foreign Bodies: As we know  ...

Ingestion of Foreign Bodies: As we know  that small children are curious and  innocence children are notorious for inserting various object into their orifices like mouth, nos

Hypodermic-subcutaneous injection , Hypodermic-Subcutaneous Injection ...

Hypodermic-Subcutaneous Injection By this route the drug is mainly absorbed into the blood stream by way of the lymphatic drainage. Absorption is slower by this route

How different are the heart chambers, Concerning the thickness of their wal...

Concerning the thickness of their walls how different are the heart chambers? The ventricle walls are thicker than the atrium walls as ventricles are structures responsible for

Explain the class reptilia perform gas, Do beings of the class Reptilia per...

Do beings of the class Reptilia perform gas exchange in the same way amphibians do? These beings do not have permeable skin so they do not make cutaneous respiration such as a

What are mineral salts, What are mineral salts? Where in living beings can ...

What are mineral salts? Where in living beings can mineral salts are found? Mineral salts are simple inorganic substances made of metallic chemical elements, such as iron, sodi

What are the main types of waste, What are the main types of waste? The...

What are the main types of waste? The waste can be classified into main types, each of them carrying its own dissimilar environmental problem: organic waste, non recyclable was

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Divergence - mechanism of gastrulation, DIVERGENC E - In it blastom...

DIVERGENC E - In it blastomeres move in different directions i.e. inside the blastocoel the blastomeres move in different directions. The blastomeres which move inside i

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd