Ecosystem control, Biology

Assignment Help:

Ecosystem Control

Another important aspect of ecosystem functioning that is how it maintains its ecological balance. By now, it must be obvious to you that an ecosystem is a dynamic system, wherein a lot of events take place. For example, animals eat and in turn are eaten, moisture and nutrients flow in and out of the system, and weathers change. In spite of all these happenings the ecosystems persist and recover from the slight disturbances. This capacity of an ecosystem to self-regulate or self-maintain is called homeostasis. Isn't this ability of ecosystems to recover from certain perturbations remarkable? Let us take a simple example to see that how is this balance maintained in spite of the fight disturbances in the ecosystem.

Consider a grassland, when there is a drought, do not grow well. The mice that eat the grass become malnourished. When this happens, their birth rate decreases. And also the hungry mice retreat to their burrows and sleep. By doing so, they need less food and are less exposed to predators, so their death rates decrease. Their behaviour protects their own population balance as well as that of the grasses which are not being consumed while the mice hibernate. Such a mechanism is known as feedback regulation and is very important to maintain the ecological balance. It is the prime regulatory mechanism for the ecosystem as a whole. You may know that there are several kinds of organisms comprising an ecosystem. So all the organisms in an ecosystem are part of several different feedback loops. A feedback loop may be defined as relationship in which a change in some original rate, alters the rate of direction of further change. In the above example, we had deliberately taken a very small group of living beings that has primarily the mice and the plants.


Related Discussions:- Ecosystem control

Primary tubercle, Primary  Tubercle  (Ghon Tubercle): When  an  indiv...

Primary  Tubercle  (Ghon Tubercle): When  an  individual with  no  previous exposure  to  tuberclosis inhale a sufficient number of  tubercle bacilli into the alveoli, tubercu

Explain systematic - modern trends in animal taxonomy, Explain Systematic -...

Explain Systematic - Modern Trends in Animal Taxonomy Systematic is defined as the study of relationship among organisms which means reconstruction of phylogenies. It is that b

What is the cell theory, Cell theory is a theory that asserts that the cell...

Cell theory is a theory that asserts that the cell is the ingredient unit of the living beings. Before the discovery of the cell, it was not examined that the living beings were

Define buffers and buffer solutions, Define Buffers and Buffer Solutions? ...

Define Buffers and Buffer Solutions? Solutions containing both weak acid and their salts or solutions containing weak hydroxides and their salts are referred to as buffer solut

Define about the sterols - non glyceride fractions, Define About the Sterol...

Define About the Sterols - Non Glyceride Fractions? These constitule a major proportion of the non-glyceride component while tocopherols, carotene pigments and flavour compound

Amount of proteins present in the cell, Cells regulate their level of activ...

Cells regulate their level of activity by regulating the amount of proteins present in the cell at any given time, so an up regulation of enzymes would be expected to A. increase t

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Pericardiocentesis-types of surgery, Pericardiocentesis :  This is us...

Pericardiocentesis :  This is usually done by the cardiologist. It is better done with ECG and haemodynamic monitoring. Subxyphoid route is preferred with the patient positio

Define classification of lipids, Define Classification of Lipids? Chemi...

Define Classification of Lipids? Chemically, lipids are the organic molecules poor in oxygen content, soluble in organic solvents but insoluble in water. They are classified as

Explain adverse effects of emtricitabine, Explain Adverse effects of Emtric...

Explain Adverse effects of Emtricitabine  Emtricitabine can cause hyperpigmentation of the palms and soles, particularly in dark-skinned patients. Because emtricitabine is also

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd