Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Ecosystem Control
Another important aspect of ecosystem functioning that is how it maintains its ecological balance. By now, it must be obvious to you that an ecosystem is a dynamic system, wherein a lot of events take place. For example, animals eat and in turn are eaten, moisture and nutrients flow in and out of the system, and weathers change. In spite of all these happenings the ecosystems persist and recover from the slight disturbances. This capacity of an ecosystem to self-regulate or self-maintain is called homeostasis. Isn't this ability of ecosystems to recover from certain perturbations remarkable? Let us take a simple example to see that how is this balance maintained in spite of the fight disturbances in the ecosystem.
Consider a grassland, when there is a drought, do not grow well. The mice that eat the grass become malnourished. When this happens, their birth rate decreases. And also the hungry mice retreat to their burrows and sleep. By doing so, they need less food and are less exposed to predators, so their death rates decrease. Their behaviour protects their own population balance as well as that of the grasses which are not being consumed while the mice hibernate. Such a mechanism is known as feedback regulation and is very important to maintain the ecological balance. It is the prime regulatory mechanism for the ecosystem as a whole. You may know that there are several kinds of organisms comprising an ecosystem. So all the organisms in an ecosystem are part of several different feedback loops. A feedback loop may be defined as relationship in which a change in some original rate, alters the rate of direction of further change. In the above example, we had deliberately taken a very small group of living beings that has primarily the mice and the plants.
Primary Tubercle (Ghon Tubercle): When an individual with no previous exposure to tuberclosis inhale a sufficient number of tubercle bacilli into the alveoli, tubercu
Explain Systematic - Modern Trends in Animal Taxonomy Systematic is defined as the study of relationship among organisms which means reconstruction of phylogenies. It is that b
Cell theory is a theory that asserts that the cell is the ingredient unit of the living beings. Before the discovery of the cell, it was not examined that the living beings were
Define Buffers and Buffer Solutions? Solutions containing both weak acid and their salts or solutions containing weak hydroxides and their salts are referred to as buffer solut
Define About the Sterols - Non Glyceride Fractions? These constitule a major proportion of the non-glyceride component while tocopherols, carotene pigments and flavour compound
Cells regulate their level of activity by regulating the amount of proteins present in the cell at any given time, so an up regulation of enzymes would be expected to A. increase t
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Pericardiocentesis : This is usually done by the cardiologist. It is better done with ECG and haemodynamic monitoring. Subxyphoid route is preferred with the patient positio
Define Classification of Lipids? Chemically, lipids are the organic molecules poor in oxygen content, soluble in organic solvents but insoluble in water. They are classified as
Explain Adverse effects of Emtricitabine Emtricitabine can cause hyperpigmentation of the palms and soles, particularly in dark-skinned patients. Because emtricitabine is also
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd