Eastern/western/venezuelan equine encephalitis, Biology

Assignment Help:

Eastern/Western/Venezuelan equine encephalitis

This encephalitis causing group of viral diseases of wild birds including pheasants, chickens, turkeys, ducks and pigeons with a high morbidity and mortality has become a matter of concern due to its transmissibility between birds and their zoonotic nature. All 3 types of infections are caused by members of the family Togaviridae, genus Alpha virus. These conditions currently occur only in North America and northern part of South America. The natural hosts are wild birds and rodents. T he viruses can also infect horses and humans. The viruses, which begin their life cycles as parasites of wild birds, are transferred to horses and humans, through saliva of mosquitoes. The most important mosquito species in maintaining the bird-mosquito transmission cycle is Culiseta melanura, which reproduces in freshwater hardwood swamps.

The symptoms of equine encephalitis in humans are fever, drowsiness and incoordination, often followed by paralysis and death. The mortality rate is 90%, usually within 2 to 3 days in the most virulent Eastern type and as high as 50% in the Western type. Equine encephalitis is a serious public-health problem in northern part of South America.

Symptoms and lesions: The birds show nervous symptoms like ataxia, paresis, paralysis, flaccid neck, circling, tremors etc. Sometimes, the infection may also be asymptomatic. On PM examination of the dead birds, no gross lesions are seen and microscopic lesions are also not pathognomonic.

Diagnosis: Isolation in baby mice, tissue culture, and developing chicken embryos can be confirmatory.

Prevention and control: General biosecurity and mosquito control policy should be adopted. Basically this is not a disease of domestic poultry however; strict vigil and early detection of any suspected mortality in backyard poultry may prevent further losses.


Related Discussions:- Eastern/western/venezuelan equine encephalitis

Which type of defense cell do bacteria attract, Which type of defense cell ...

Which type of defense cell do bacteria attract and cause to multiply during the inflammation process? What is the name given to the waste material produced by the inflammation trig

What is paedomorphosis. explain in brief., What is Paedomorphosis. Explain ...

What is Paedomorphosis. Explain in brief. When sexually mature adults have characteristics which would normally be associated with the larval stage. It happens since reproducti

Radial and biradial - metazoa, Radial and Biradial-Metazoa Radial sym...

Radial and Biradial-Metazoa Radial symmetry is the symmetry in which the parts are so arranged around a central axis or shaft, like the spokes of a wheel, that any vertical c

Supportive therapy for diabetes patient, Q. Supportive Therapy for diabetes...

Q. Supportive Therapy for diabetes patient? Certain foods, part of food or food components have been found to be beneficial in managing hyperglycemia. Most of these have been i

Determine the type of bandage, Determine the type of bandage The most com...

Determine the type of bandage The most common type of bandage is the gauze bandage, a simple woven strip of material which comes in different widths and lengths.

What is salty taste, Q. What is Salty taste? Various ions both cations ...

Q. What is Salty taste? Various ions both cations and anions are responsible for the salty taste. These include: K (Potassium), Na (Sodium), Li (Lithium), Cl, Br (Bromine), I (

Zoology, About phylum platy helmenthus

About phylum platy helmenthus

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Process of conducting system of the heart, Impulses reaching the AV node fr...

Impulses reaching the AV node from the atria are delayed a little as they pass through the trunk and crura. The impulses first reach the papillary muscles and their contraction clo

Why is pattern baldness more common in men than in women, Why is pattern ba...

Why is pattern baldness more common in men than in women? Pattern baldness is handled by the allele B. Testosterone interacts with the heterozygous genotype (BB′) to make baldn

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd