Dna replication in eukaryotes, Biology

Assignment Help:

DNA replication in eukaryotes is much more complex than in prokaryotes while there are various same aspects. The Eukaryotic cells can only initiate DNA replication at a particular point in the cell cycle, the starting of S phase.  The DNA replication in eukaryotes happens only in the S phase of the cell cycle. Furthermore, pre-initiation happens in the G1 phase. Thus, pre-initiation and activation needs two very several intra-cellular contexts to follow each other in the right order making it very unlikely which replication will take place more than once per cell cycle.

With the Due to the sheer size of chromosomes in eukaryotes and eukaryotic chromosomes hold multiple origins of replication. Some origins are well characterized, like the ARS (autonomously replicating sequences) of yeast although other eukaryotic origins, mainly those in metazoan which can be found in spans of thousands of basepairs. Though, the initiation and assembly of replicaton is similar in both the metazoa and protozoa.

 


Related Discussions:- Dna replication in eukaryotes

Copper - mineral elements, COPPER It is a trace element which is availa...

COPPER It is a trace element which is available in most of the fruits. Maximum in heart, brain, kidney & crustaceans. By its deficiency monkin's disease is caused. Cop

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Mm, #questionmmmm

#questionmmmm

Bovine rotavirus diarrhoea, B o v i ne rotavirus diarrhoea The bovi...

B o v i ne rotavirus diarrhoea The bovine rotavirus is a RNA virus with 11 segments of double stranded RNA belonging to the genus Rotavirus in the family Reoviridae. Rotavi

The human impact on the environment, what are the principle sources of exce...

what are the principle sources of excessive nitrate and phosphate in rivers and lakes?

Explain adverse effects of cidofovir, Explain Adverse Effects of Cidofovir ...

Explain Adverse Effects of Cidofovir About 25% of patients discontinue cidofovir because of adverse effects such as nephrotoxicity, neutropenia and metabolic acidosis. Iritis,

Can you define the vena cava, Q. What is the vena cava? Which type of blood...

Q. What is the vena cava? Which type of blood circulates within the vena cava? The vena cava is either of two large veins that debouch into the right atrium the superior vena c

Functional regurgitation-types of regurgitation, Functional Regurgitation :...

Functional Regurgitation :  Dilatation of right ventricle and tricuspid annulus leads to regurgitation. This is the most common type associated with mitral valve disease and

Effect on water bodies - dissolved oxygen (do), Effect on Water Bodies - Di...

Effect on Water Bodies - Dissolved Oxygen (DO) Most aquatic, organisms respire with oxygen dissolved in water. The quantity of dissolved oxygen in a unit volume of aerated wa

What is the evolutionary importance of pteridophytes, Q. What is the evolut...

Q. What is the evolutionary importance of pteridophytes? As the first pteridophytes, tracheophytes were also the first plants to extensively colonize the terrestrial environmen

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd