Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
DNA replication in eukaryotes is much more complex than in prokaryotes while there are various same aspects. The Eukaryotic cells can only initiate DNA replication at a particular point in the cell cycle, the starting of S phase. The DNA replication in eukaryotes happens only in the S phase of the cell cycle. Furthermore, pre-initiation happens in the G1 phase. Thus, pre-initiation and activation needs two very several intra-cellular contexts to follow each other in the right order making it very unlikely which replication will take place more than once per cell cycle.
With the Due to the sheer size of chromosomes in eukaryotes and eukaryotic chromosomes hold multiple origins of replication. Some origins are well characterized, like the ARS (autonomously replicating sequences) of yeast although other eukaryotic origins, mainly those in metazoan which can be found in spans of thousands of basepairs. Though, the initiation and assembly of replicaton is similar in both the metazoa and protozoa.
COPPER It is a trace element which is available in most of the fruits. Maximum in heart, brain, kidney & crustaceans. By its deficiency monkin's disease is caused. Cop
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
#questionmmmm
B o v i ne rotavirus diarrhoea The bovine rotavirus is a RNA virus with 11 segments of double stranded RNA belonging to the genus Rotavirus in the family Reoviridae. Rotavi
what are the principle sources of excessive nitrate and phosphate in rivers and lakes?
Explain Adverse Effects of Cidofovir About 25% of patients discontinue cidofovir because of adverse effects such as nephrotoxicity, neutropenia and metabolic acidosis. Iritis,
Q. What is the vena cava? Which type of blood circulates within the vena cava? The vena cava is either of two large veins that debouch into the right atrium the superior vena c
Functional Regurgitation : Dilatation of right ventricle and tricuspid annulus leads to regurgitation. This is the most common type associated with mitral valve disease and
Effect on Water Bodies - Dissolved Oxygen (DO) Most aquatic, organisms respire with oxygen dissolved in water. The quantity of dissolved oxygen in a unit volume of aerated wa
Q. What is the evolutionary importance of pteridophytes? As the first pteridophytes, tracheophytes were also the first plants to extensively colonize the terrestrial environmen
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd