Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
DIFFERENCES BETWEEN SINGLE-UNIT AND MULTI-UNIT SMOOTH MUSCLES
Single-unit Smooth Muscles
Multi-unit Smooth Muscles
1.
They are composed of muscle fibres closely
They are composed of muscle fibres not so
joined together.
closely joined together.
2.
All the fibres of single smooth muscle
All the fibres of a multiunit muscle contract
contract together as a single unit.
as separate units.
3.
Muscles of the wall of hollow visceral organs
Muscles of the wall of large blood vessels,
(e.g., Gastrointestinal tract and urinary
arrector pili muscles of skin dermis, ciliar and
bladder) are examples of this type of muscles.
iris muscles in the eyes are examples of this
type of muscles.
Nucleic Acids Friedrich Miescher (1868) discovered the presence of these compound in protoplasm ,but Altman (1889) introduced the term Nucleic acid. These acids are the lar
What is the main cell organelle involved in cell digestion? What are the properties of that organelle that enable it to do the task? The organelles responsible for intracellula
Why is the cartilage more flexible than bone? in general, why does cartilage take longer to repair than bone?
What is Pulsus Bisferians explain in details? Pulsus Bisferians: A condition in which double notch is found near or at the height of pulse wave. Typically it is associated with
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is compound that is phosphorylated for ATP formation? What is resulting compound when ATP liberates energy? adenosine triphosphate or ATP is formed after the binding of
Explain Problems of Infants and Preschoolers Nutrition? In spite of all nutrition interventions, there are some of the common yet life threatening problems which need to be loo
Which one of the following does not follow the central dogma of molecular biology? 1. Pea 2. Mucor 3. Chlamydomonas 4. HIV HIV is the central dogma of molecular bi
Water soluble Vitamin A Water soluble vitamin A is a yellowish green, slightly turbid, fluorescent liquid of faint characteristic odour. The taste is at first faintly sweet an
classification schemes and characterisitics used for this.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd