Diploidy and haploidy, Biology

Assignment Help:

Diploidy and Haploidy :: In the chromosomal complement  given species  not all the  chromosomes are different  from each other .In fact these  are in pairs ,i.e.  every  two chromosomes of the  karyotype  are similar  in shapes  size and  structure or say  are homologous, Obviously  the chromosomes   of one pairs  are different from  those of every  other pair. This  means  that the karyotype in fact  comprises two  similar sets of chromosomes, Hence it  is called diploid )2x or 2n,)

In sexual reproduction ,union of two  different  sex cells  or gametes  (male gamete or sperm cell and  female gamete or ovum) occur  to form a single diploid  cell called  zygote. From  the zygote, all body  cells  of a new  individual  arise by  repeated   mitotic divisions. Thus the karyotypic diploid chromosomal  complement  is transmitted  to all  body  cells. However  to prevent   multiplication  of the diploid  complement the sex  cells must contain  only half  the number  or say a single  set or chromosomes .This gametic chromosomal complement is thus, haploid (x or n) and  called genome, in contrast  to the  karyotype  of diploid  somatic cells, Obviously  of the  two sets  of chromosomal in a karyotype in every  individual, one is originally  obtained from male and the  other female parents.

 


Related Discussions:- Diploidy and haploidy

What is replication, Question 1 Write a short note on the following- ...

Question 1 Write a short note on the following- Structure of DNA. Satellite DNA Transcription. pBR 322 vector Cytokines Microarrays Question 2 What is

Illustrate morphological evidence, Q. Illustrate Morphological Evidence? ...

Q. Illustrate Morphological Evidence? Morphology is the study of structure and form of plants and animals usually dealing with the organism and its component organs. Morphologi

Why the diluent is distilled water, A drug has a molec. weight of 200. How ...

A drug has a molec. weight of 200. How many grams would you use to make 100 ml of a solution that is isotonic (for man)? Assume that the diluent is distilled water and that the dru

Define sex-linked inheritance of nonmendelian inheritance, Why is sex-linke...

Why is sex-linked inheritance an example of nonmendelian inheritance? The Sex-linked inheritance is a kind of nonmendelian inheritance because it opposes Mendel's first law, wh

Causes of heart failure, It is important to recognise underlying causes and...

It is important to recognise underlying causes and precipitating factors of heart failure for its appropriate management. That would also help in prevention and treatment of heart

What is risk, What is Risk  Risk  :  A function of the probability o...

What is Risk  Risk  :  A function of the probability of an adverse effect and  the magnitude of that  effect,  consequential to hazard(s)  in food.

Clathrin-coated pits and vesicles, Clathrin-coated pits and vesicles are in...

Clathrin-coated pits and vesicles are included in both the endocytosis   of material   at the plasma membrane and the exocytosis of proteins from the Golgi   apparatus.  Electron

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the stochasticity, Explain the Stochasticity? Ubiquitous noise ...

Explain the Stochasticity? Ubiquitous noise in biological systems creates stochastic methods central to modelling attempts. Stochasticity is available at all levels in environm

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd