Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Diploidy and Haploidy :: In the chromosomal complement given species not all the chromosomes are different from each other .In fact these are in pairs ,i.e. every two chromosomes of the karyotype are similar in shapes size and structure or say are homologous, Obviously the chromosomes of one pairs are different from those of every other pair. This means that the karyotype in fact comprises two similar sets of chromosomes, Hence it is called diploid )2x or 2n,)
In sexual reproduction ,union of two different sex cells or gametes (male gamete or sperm cell and female gamete or ovum) occur to form a single diploid cell called zygote. From the zygote, all body cells of a new individual arise by repeated mitotic divisions. Thus the karyotypic diploid chromosomal complement is transmitted to all body cells. However to prevent multiplication of the diploid complement the sex cells must contain only half the number or say a single set or chromosomes .This gametic chromosomal complement is thus, haploid (x or n) and called genome, in contrast to the karyotype of diploid somatic cells, Obviously of the two sets of chromosomal in a karyotype in every individual, one is originally obtained from male and the other female parents.
what are the function of nucleus
Question 1 Write a short note on the following- Structure of DNA. Satellite DNA Transcription. pBR 322 vector Cytokines Microarrays Question 2 What is
Q. Illustrate Morphological Evidence? Morphology is the study of structure and form of plants and animals usually dealing with the organism and its component organs. Morphologi
A drug has a molec. weight of 200. How many grams would you use to make 100 ml of a solution that is isotonic (for man)? Assume that the diluent is distilled water and that the dru
Why is sex-linked inheritance an example of nonmendelian inheritance? The Sex-linked inheritance is a kind of nonmendelian inheritance because it opposes Mendel's first law, wh
It is important to recognise underlying causes and precipitating factors of heart failure for its appropriate management. That would also help in prevention and treatment of heart
What is Risk Risk : A function of the probability of an adverse effect and the magnitude of that effect, consequential to hazard(s) in food.
Clathrin-coated pits and vesicles are included in both the endocytosis of material at the plasma membrane and the exocytosis of proteins from the Golgi apparatus. Electron
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the Stochasticity? Ubiquitous noise in biological systems creates stochastic methods central to modelling attempts. Stochasticity is available at all levels in environm
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd