Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Differentiate between sterilization and disinfection?
1) Sterilization is defined as freeing the object or substance from all life of any kind. It is the process by which an article, surface or medium is freed of fall micro-organisms either in the vegetative or spore state.
Disinfection means the killing removal or destruction of organisms capable of causing infection namely pathogens.
2) Cross contamination is the passage of micro-organisms from one person to another via any route direct or indirect.
what is biodiversity
Material Basis of Primitive Life: In the primitive society, human beings invented tools for catching animals, and for collecting, transporting and even preparing food. They l
Describe the factors that are involved in the regulation of respiration in a child who decides to hold his/her breath for as long as possible.
MITOCHONDRIA (Singular- MITOCHONDRION) These are conspicuous, hollow sac liked cell organelles found in all eukaryotic cells except mature red blood corpuscles RBC s
Q. Principal categories in classification? First of all there is a need to know what classification is? Let us define in simple term. Classification is placing of a plant (or g
Define Fat needs in Nutrient Requirement and Dietary Management? As we have learnt earlier on enteral and parenteral feedings; administration of lipids should be carried out ca
Explain the Acoelomates - Animals without a Body Cavity? The simplest group of animals that has bilateral symmetry and a solid body (acoelomate) is the Platyhelminthes. Phy
Do a bit of research on gene splicing, a DNA technology that bioengineers can use to create organisms with traits that never before seen in nature (herbicide-resistant crops, mice
Q. Explain about Food Exchange System? In a diabetic's day to day diet, the calorie intake and the quantity of food consumed should not have wide fluctuations. Also the diet sh
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd