Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is a species?
A species is a set of living beings able to cross between themselves generating fertile offspring.
This concept though does not apply to individuals of exclusive asexual reproduction and so other definitions have been proposed. For instance, "a species is a set of living beings that include in a common manner all of them considered ancestors of the similar type in relation to common descendants".
Q. What do you mean by Ulcerative Colitis? Let us understand clearly about ulcerative colitis by reading the following case. Varun, a 48-year-old male, had a very successful
Treatment of Lyme Disease Lyme disease in North America is caused by the spirochete Borrelia burgdorferi, which is transmitted to humans by Ixodes scapularis or pacificus tick
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
what is respiration in animals ,its functions ,types of respiration
Can you give me an example of the species that crossed a few habitats?
What is Respiratory System explain their functionality ? The respiratory system is responsible for the transport of oxygen and carbon dioxide from outside the body to and from
What is Molting? Explain in brief. The periodic shedding of outer body covering of an animal. The term is applied to a variety of things including: loss of the outer exoskeleto
Metalimnion - Summer Stratification This zone lies below the epilimnion and above the hypolimnion and thus forms the intermediate layer which is non-circulating. The metalimni
Surgical preparation of the bone - drill technique It is essential not to allow the bone to be heated above 47°C during preparation of the site as this will cause bone cell dea
simplest way to learn their classifiction
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd