Define the term- species, Biology

Assignment Help:

What is a species?

A species is a set of living beings able to cross between themselves generating fertile offspring.

This concept though does not apply to individuals of exclusive asexual reproduction and so other definitions have been proposed. For instance, "a species is a set of living beings that include in a common manner all of them considered ancestors of the similar type in relation to common descendants".

 


Related Discussions:- Define the term- species

What do you mean by ulcerative colitis, Q. What do you mean by Ulcerative C...

Q. What do you mean by Ulcerative Colitis? Let us understand clearly about ulcerative colitis by reading the following case. Varun, a 48-year-old male, had a very successful

Explain the treatment of lyme disease, Treatment of Lyme Disease Lyme d...

Treatment of Lyme Disease Lyme disease in North America is caused by the spirochete  Borrelia burgdorferi, which is transmitted to humans by Ixodes scapularis or pacificus tick

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Respiration in animal, what is respiration in animals ,its functions ,types...

what is respiration in animals ,its functions ,types of respiration

Species and habitats, Can you give me an example of the species that crosse...

Can you give me an example of the species that crossed a few habitats?

What is respiratory system explain their functionality , What is Respirator...

What is Respiratory System explain their functionality ? The respiratory system is responsible for the transport of oxygen and carbon dioxide from outside the body to and from

What is molting, What is Molting? Explain in brief. The periodic sheddi...

What is Molting? Explain in brief. The periodic shedding of outer body covering of an animal. The term is applied to a variety of things including: loss of the outer exoskeleto

Metalimnion - summer stratification, Metalimnion - Summer Stratification ...

Metalimnion - Summer Stratification This zone lies below the epilimnion and above the hypolimnion and thus forms the intermediate layer which is non-circulating. The metalimni

Determine surgical preparation of the bone - drill technique, Surgical prep...

Surgical preparation of the bone - drill technique It is essential not to allow the bone to be heated above 47°C during preparation of the site as this will cause bone cell dea

Echinoderms, simplest way to learn their classifiction

simplest way to learn their classifiction

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd