Define the binge eating disorder, Biology

Assignment Help:

Define the Binge Eating Disorder?

Binge eating disorder is probably the most common eating disorder. Binge eating you may recall we studied as an element of bulimia nervosa. In Bulimia, however, episodes of binge eating are followed by inappropriate behaviour such as purging, periods of fasting, or performance of strenuous exercise. People with binge eating disorder, by contrast, do not purge, fast or engage in strenuous exercise after binge eating. Additionally, people with bulimia are typically of normal weight or may be slightly overweight (the purging,etc., have little to no effect on the subject's body fat), whereas people with binge eating disorder are typically overweight or obese.

Binge eating disorder is a psychiatric disorder in which a subject:

  • Periodically does not exercise control over consumption of food,
  • Eats an unusually large amount of food at one time,
  • Eats much more quickly during binge episodes than during normal eating episodes, eats until physically uncomfortable,
  • Eats large amounts of food, even when they are not really hungry,
  • Always eats alone during binge eating episodes, in order to avoid discovery of the disorder,
  • Often eats alone during periods of normal eating, owing to feelings of embarrassment about food, and
  • Feels disgusted, depressed, or guilty after binge eating.

Related Discussions:- Define the binge eating disorder

What is phylum hemichordata, What is Phylum Hemichordata ? The name "he...

What is Phylum Hemichordata ? The name "hemi"; (meaning "half") provides a clue to these animals, which have some of the features of chordates, and some features that are chara

Use of examination gloves, Q. Use of Examination Gloves? Examination Gl...

Q. Use of Examination Gloves? Examination Gloves - latex, vinyl, nitrile, neoprene Gloves are worn whenever contact with blood, saliva, mucous membranes or blood/saliva-cont

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Cortex, Cortex  can be described as follows 1) The outer part of the org...

Cortex  can be described as follows 1) The outer part of the organ, such as, the adrenal cortex, which produces many steroidhormones;  2) in plants, the area of the stem or root

Synergistic and sequential effects of hormones, Synergistic and Sequential ...

Synergistic and Sequential Effects of Hormones In vitro studies on callus and suspension cultures have brought out two interesting findings. The nature and direction of differ

The reproductive system of house fly, The reproductive system of house fly:...

The reproductive system of house fly: In houseflies seperate male and female organisms are present. Male housefly reproductive system. The male hothe reproductive syste

What is the significance of the epiglottis in human body, What is the signi...

What is the significance of the epiglottis in human body? What happens to the glycogen concentration in the liver cells when the level of adrenaline enhances in the blood strea

How emulsion can stabilized, How emulsion can stabilized Emulsions can ...

How emulsion can stabilized Emulsions can be stabilized by the use of emulsifiers, finely divided particles adsorbed at the interface and water dispersible hydrocolloids. Emuls

Explain about the nucleoproteins, Explain about the Nucleoproteins? Nuc...

Explain about the Nucleoproteins? Nucleoproteins are combinations of nucleic acids land simple proteins, which usually consists of a large number of basic amino acids. Nucleopr

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd