Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the Binge Eating Disorder?
Binge eating disorder is probably the most common eating disorder. Binge eating you may recall we studied as an element of bulimia nervosa. In Bulimia, however, episodes of binge eating are followed by inappropriate behaviour such as purging, periods of fasting, or performance of strenuous exercise. People with binge eating disorder, by contrast, do not purge, fast or engage in strenuous exercise after binge eating. Additionally, people with bulimia are typically of normal weight or may be slightly overweight (the purging,etc., have little to no effect on the subject's body fat), whereas people with binge eating disorder are typically overweight or obese.
Binge eating disorder is a psychiatric disorder in which a subject:
What is Phylum Hemichordata ? The name "hemi"; (meaning "half") provides a clue to these animals, which have some of the features of chordates, and some features that are chara
Q. Use of Examination Gloves? Examination Gloves - latex, vinyl, nitrile, neoprene Gloves are worn whenever contact with blood, saliva, mucous membranes or blood/saliva-cont
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Cortex can be described as follows 1) The outer part of the organ, such as, the adrenal cortex, which produces many steroidhormones; 2) in plants, the area of the stem or root
Synergistic and Sequential Effects of Hormones In vitro studies on callus and suspension cultures have brought out two interesting findings. The nature and direction of differ
The reproductive system of house fly: In houseflies seperate male and female organisms are present. Male housefly reproductive system. The male hothe reproductive syste
what is evolution
What is the significance of the epiglottis in human body? What happens to the glycogen concentration in the liver cells when the level of adrenaline enhances in the blood strea
How emulsion can stabilized Emulsions can be stabilized by the use of emulsifiers, finely divided particles adsorbed at the interface and water dispersible hydrocolloids. Emuls
Explain about the Nucleoproteins? Nucleoproteins are combinations of nucleic acids land simple proteins, which usually consists of a large number of basic amino acids. Nucleopr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd