Chemical changes during cleavage, Biology

Assignment Help:

CHEMICAL CHANGES DURING CLEAVAGE -

1.       Synthesis of DNA occurs.

2.       Synthesis of RNA (rRNA is absent, mRNA & tRNA are synthesized very little amount).

3.       Protein synthesis take place - The nucleo histone protein are used in chromosome replication & tubulin protein is used for the formation of microtubules fibres.


Related Discussions:- Chemical changes during cleavage

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Medication for cardiac patients, Medication The patient is advised to ...

Medication The patient is advised to continue antibiotics for a week more after discharge. Other medications prescribed are analgesics (acetaminopen), cough syrup, diuretics

Causes of non-ketotic hyperosmolar diabetic coma, Q. Causes of Non-Ketotic ...

Q. Causes of Non-Ketotic Hyperosmolar Diabetic Coma? The causes of NKHDC are given below: 1) Infections 2) Trauma 3) Burns 4) Myocardial Infarctions (heart attack)

Illustrate the maturation of honey, Q. Illustrate the maturation of honey? ...

Q. Illustrate the maturation of honey? Honey is the oldest sweet food known to man. Although honey is a natural sweetener, it is considered a refined sugar because 96% of dr

Zoology, Write briefly on neural mechanism of learning?

Write briefly on neural mechanism of learning?

Define the stages of convaiescenca - nutrition during stress, Define the St...

Define the Stages of ConvaIescenca - Nutrition during Stress? This period of catabolism and alteration of the hormonal environment is known as the 'adrenergic - corticoid phase

Carbohydrates, Carbohydrates These form about 1%part of protoplasm, the...

Carbohydrates These form about 1%part of protoplasm, they are comparatively simpler compounds of carbon, hydrogen and oxygen in the ratio 1:2:1 The ratio hydrogen to oxygen is

Addition of glycine to the physiological saline, Addition of glycine to the...

Addition of glycine to the physiological saline A complete motor neuron is removed from a frog and placed in a large volume of normal physiological saline.  The neuron is heal

Measurement of functional property of fats and oil, Measurement of Function...

Measurement of Functional Property of fats and oil Fats and oils have several functional properties that affect the quality of processed foods. In deep fat frying, the roles p

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd