Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain intravascular fluid compartment - extracellular fluid?
The extracellular fluid compartment is sub-divided into the intravascular fluid compartment (fluid within the blood vessel) and intercellular/interstitial/ extravascular fluid compartment (fluid between the body cells but outside of the blood vessel).
The intravascular fluid comprises of all the fluid within the blood vessels of the "vascular" system - namely, the arteries, veins and capillaries. The intercellular compartment, on the other hand, contains the fluid around and between the cells of the body, which carries nutrients to the cells and collects waste products for eventual excretion.
The intravascular fluid is separated from the intercellular fluid by the walls of the blood vessels, which also form a semipermeable barrier that allows the water to pass through it but exerts a strict selective control over the passage of other chemicals.
Define Poverty Alleviation to control under nutrition? There are a number of development programmes aiming at employment assurance to the landless and other labour with a focus
Together, genomics, proteomics and transcriptomics are influential approaches to enhancing our understanding not only of how cells function normally but also what the key modificat
Q. Vitamins requirement in dyslipidemia? Antioxidants and flavonoids, natural vitamin E, vitamins C and Aare nutrients (vitamins) that scavenge cell-damaging free radicals and
Inhibitor Proteins - Enzyme-activity Control One kind of inhibitor protein found in higher plants is an endopeptidase which degrades nitrate reductase thus causing irreversibl
Direct demonstration of the causative agent by electron microscopy (EM): Where facilities for electron microscopy are available and a viral disease is suspected, presence o
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Give examples of both aerobic and anaerobic exercises Games like foot ball and basket ball, involve both aerobic and anaerobic exercises. As you are aware, in modern times a n
HACCP Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
1. The Combination Of Rapid Industrial Growth, Lack Of Regulations, Inadequate Supervision Of Safety Measures By The Authorities And Lack Of Sufficient Opportunities For The L
Define Preoperative Nutritional Care during Surgery? It can be provided only to prospective candidates of elective surgery and is not feasible for emergency cases. Preoperative
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd