Define association between inflammation and fever, Biology

Assignment Help:

Q. What is the association between inflammation and fever?

In the tissue region where inflammation occurs prostaglandins, cytokines, bacterial toxins, interleukins and endothelins are released. These substances gain the circulation and reach the central nervous system which then commands the raise of the body temperature.


Related Discussions:- Define association between inflammation and fever

Blood, what are the component of hemoglobin

what are the component of hemoglobin

Reproduction., in oogenesis only on functional egg cell is normally formed ...

in oogenesis only on functional egg cell is normally formed from primary oocyte. Briefly explain

Nature of viral diseases, N a ture of viral diseases Viral diseases ...

N a ture of viral diseases Viral diseases are manifested in acute, sub-acute or chronic forms, as frank clinical cases or as latent infections, some of which are fatal. Thes

Define protein requirements for physical fitness, Define Protein Requiremen...

Define Protein Requirements for physical fitness? Proteins provide energy to the body. Since exercise may increase an athlete's need for protein, depending on the type and freq

Invertebrate, classification of invertebrate

classification of invertebrate

Determine the alpha-islet cells of the pancreas, Determine the alpha-islet ...

Determine the alpha-islet cells of the pancreas. Person X is a healthy human who has volunteered to take experimental drug Y.  Person X has a normal dinner at 6 PM on April 1 a

Mollusca, what is phylum mollusca?

what is phylum mollusca?

Explain the food security, Explain the Food Security? You were introduc...

Explain the Food Security? You were introduced to the concept of food security in Unit 2. Food security, we learnt, is access by all people at all times to enough food for an a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What do you man by extracellular digestion, Q. Concerning extracellular dig...

Q. Concerning extracellular digestion what is meant by chemical digestion? Chemical digestion is the series of enzymatic reactions to break macromolecules into smaller ones.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd