Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What do you mean by crystalline style? A rodlike structure in some mollusc stomachs which is made of enzymatic proteins required for digestion. Cilia lining the stomach rotate
ESR and CRP are elevated in almost all patients of arthritis and carditis and rarely in patients with chorea. ESR should be repeated periodically as it is useful in following the c
SUBERIN It is a lipid formed by esterification of phellonic acid or its derivative with glycerol. Suberin occurs in the walls of cork cells and endodermal cells. It makes
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
about how humans survive and reproduce currently. In your journal, write down three adaptations that help humans have differential survivability, and three adaptations that help hu
Explain the Criteria for Assessment of Vitamin Status? Vitamin E is assessed by determining the plasma lipid fraction levels. 0.8 mg of total tocopherol/g total plasma lipids i
Q. What are risk factors for diseases? The Risk factors for a disease are everything that contributes to increase the risk of the disease to appear. For example, for most cardi
Discuss in detail about the human brain "wiring-up" of our brain begins in early development. When our genetic blueprint largely drives this wiring in womb, a newborn baby's b
Q. Where can RNA are found within cells? In the eukaryote cell nucleus the RNA can be found to dispersed in the nuclear fluid, along with the DNA, and as the main constituent o
Explain the Principle or Theory of biuret method? If a strongly alkaline solution of Biuret is heated with very dilute copper sulphate, a violet colour is obtained. The substan
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd