Aortic valve replacement with replacement of aortic root, Biology

Assignment Help:

Aortic Valve Replacement with Replacement of Aortic Root : When there is aneurysm of ascending aorta with aortic regurgitation, aortic root replacement is done. This can be done with a composite graft of Dacron with a prosthetic valve (BENTAL Procedure). In this procedure, the coronaries are re implanted into the Dacron graft. Alternatively, homograft aorta with valve can be used as in Bental procedure with reimplantation of the coronary arteries.

Related Discussions:- Aortic valve replacement with replacement of aortic root

Skeleton, what are the biological significance of the skeleton?

what are the biological significance of the skeleton?

Concentration Gradients and Membrane Permeability, 3. Which substance(s) cr...

3. Which substance(s) crossed the dialysis membrane? Support your response with data-based evidence.

Explain butylated hydroxyanisole, Butylated hydroxyanisole (BHA) It is ...

Butylated hydroxyanisole (BHA) It is commercially available as a mixture of two isomers and has found wide commercial use in the food industry. It is highly soluble in oil and

Protozoa phylum, wht is the main quality of this phylum

wht is the main quality of this phylum

Define influence of polyphenols on proteins, Define Influence of Polyphenol...

Define Influence of Polyphenols on Proteins? You know that tannins are considered as anti-nutritional because their presence is usually accompanied by a reduced protein digesti

State about maxillary sinus, Maxillary sinus : It is a pyramidal shaped...

Maxillary sinus : It is a pyramidal shaped large cavity in the body of the maxilla containing many structures of concern during surgery. The sinus is lined by a membrane known

Humans have selectively bred many radically, Humans have selectively bred m...

Humans have selectively bred many radically different domestic animals(e.g., St. Bernard and Chihuahua dog breeds). Does this activity result in evolution? why or why not?

Explain in brief about the ciliary muscle, Explain in brief about the cilia...

Explain in brief about the ciliary muscle During accommodation the ciliary muscle contracts and in turn the size of the ciliary ring is reduced. This results in the suspensory

Benzoic acid and salts -preservative, Normal 0 false false ...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages