Discuss whether the decision to build the factory

Assignment Help Other Subject
Reference no: EM133208929

Question - ABC Sdn Bhd is one of the largest pharmaceutical companies in Malaysia with the aim and vision to provide Malaysians with the best affordable generic medicines. Generic medicines provide the same clinical benefits and effectiveness as the branded ones, but the generic ones can be purchased at a much lower price. To fulfill the vision of ABC Sdn Bhd, the company had built a factory/ plant at Kampung Melur beside the Melur River. The Melur River is the natural habitat for fish and wildlife such as freshwater catfish, bass, and other endangered species as well as source of food for the residents of Kampung Melur. Recently, the residents of Kampung Melur discovered a mountain of dead fish and other wildlife at the Melur River. In addition, some residents who have been consuming the water and fishes caught at the Melur River became ill. They suspected that it was due to the toxic pollution discharged from ABC Sdn Bhd factory.

With reference to the above scenario, discuss whether the decision to build the factory at Kampung Melur is considered as ethical or unethical by applying Utilitarianism and Kantian Theory.

Reference no: EM133208929

Questions Cloud

How does chronic hypoxemia lead to polycthemia : How does chronic hypoxemia lead to polycthemia and What effects do hypoxic vasoconstriction and polycythemia have on the circulatory system
How many cells were plated on all 4 plates : How many cells were plated on all 4 plates? How many colonies total? Thus how many DNA molecules were able to transform those cells
Write a set of at least four ethical behaviours : Write a set of at least four ethical behaviours that you intend to abide by in your work as a real estate agent, based on your knowledge
What secondary structure is typically bound : What secondary structure is typically bound by the translocon during co-translational transport but is not cleaved by a signal peptidase
Discuss whether the decision to build the factory : Discuss whether the decision to build the factory at Kampung Melur is considered as ethical or unethical by applying Utilitarianism and Kantian Theory
Explain the evidence for evolution : Explain the evidence for evolution? What evidence did Darwin use to explain his theory of evolution? What do we know today that we didn't know then
Discuss the main dimensions for classification : Discuss the main dimensions for classification of networked e-business. Discuss the main business directions and operations related to networked e-business
What amino acid sequence will be generated : What amino acid sequence will be generated based on this strand of DNA? Use Figure 16.6 in your text book 3TACCGCTTACTGAAAGTTATT
Advise jackie on the sale of the farm house : The second issue she is having is regarding a rental property that she owns. Advise Jackie on the sale of the farm house

Reviews

Write a Review

Other Subject Questions & Answers

  Cross-cultural opportunities and conflicts in canada

Short Paper on Cross-cultural Opportunities and Conflicts in Canada.

  Sociology theory questions

Sociology are very fundamental in nature. Role strain and role constraint speak about the duties and responsibilities of the roles of people in society or in a group. A short theory about Darwin and Moths is also answered.

  A book review on unfaithful angels

This review will help the reader understand the social work profession through different concepts giving the glimpse of why the social work profession might have drifted away from its original purpose of serving the poor.

  Disorder paper: schizophrenia

Schizophrenia does not really have just one single cause. It is a possibility that this disorder could be inherited but not all doctors are sure.

  Individual assignment: two models handout and rubric

Individual Assignment : Two Models Handout and Rubric,    This paper will allow you to understand and evaluate two vastly different organizational models and to effectively communicate their differences.

  Developing strategic intent for toyota

The following report includes the description about the organization, its strategies, industry analysis in which it operates and its position in the industry.

  Gasoline powered passenger vehicles

In this study, we examine how gasoline price volatility and income of the consumers impacts consumer's demand for gasoline.

  An aspect of poverty in canada

Economics thesis undergrad 4th year paper to write. it should be about 22 pages in length, literature review, economic analysis and then data or cost benefit analysis.

  Ngn customer satisfaction qos indicator for 3g services

The paper aims to highlight the global trends in countries and regions where 3G has already been introduced and propose an implementation plan to the telecom operators of developing countries.

  Prepare a power point presentation

Prepare the power point presentation for the case: Santa Fe Independent School District

  Information literacy is important in this environment

Information literacy is critically important in this contemporary environment

  Associative property of multiplication

Write a definition for associative property of multiplication.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd