Advise jackie on the sale of the farm house

Assignment Help Business Law and Ethics
Reference no: EM133208925

Question - Jackie has been really happy with your advice so far. She is now dealing with another legal issue regarding some properties that she owns. She recently sold her farm house in Spotsylvania and moved to a house closer to her office in Manassas. She used the same title company for both the sale and purchase of the two properties. She recently received a summons to appear in the general district court in Spotsylvania regarding a claim that she did not have the right to sale the farm house in Spotsylvania. She inherited the farm house from her mother who she believed own the house. The law suit alleges that her mother only had a life estate in the property. She believed that her mother owned the house which had been in their family for three generation. She wants to understand what is a life estate. She then wants to know if the house that has passed three generation could be a life estate.

The second issue she is having is regarding a rental property that she owns. She has a tenant that installed three items in the home. The lease has expired and she is now concerned that the tenant will take out the items and effect the value of the home. They removed and replaced a chandelier in the dining room. They also installed a gas stove which required the installation of a gas pipe which upon removal would leave a pipe and large whole when removed. The last item is a refrigerator.

Advise Jackie on the sale of the farm house.

Advise Jackie on the status of the items in her rental property and whether or not she can keep them.

Reference no: EM133208925

Questions Cloud

Discuss whether the decision to build the factory : Discuss whether the decision to build the factory at Kampung Melur is considered as ethical or unethical by applying Utilitarianism and Kantian Theory
Explain the evidence for evolution : Explain the evidence for evolution? What evidence did Darwin use to explain his theory of evolution? What do we know today that we didn't know then
Discuss the main dimensions for classification : Discuss the main dimensions for classification of networked e-business. Discuss the main business directions and operations related to networked e-business
What amino acid sequence will be generated : What amino acid sequence will be generated based on this strand of DNA? Use Figure 16.6 in your text book 3TACCGCTTACTGAAAGTTATT
Advise jackie on the sale of the farm house : The second issue she is having is regarding a rental property that she owns. Advise Jackie on the sale of the farm house
Apply the relevant cogdon facts to the case you discussed : Discuss the facts from that case, the court's reasoning, and its ruling. Apply the relevant Cogdon facts to the case you discussed
Explain what strict liability means in criminal law : Explain what strict liability means in criminal law. Support your explanation with a primary authority or a secondary scholarly source from Westlaw
Has tech savvy corp made sufficient : Question - An exciting new company, Tech Savvy Corp., designs and builds printer consoles. Has Tech Savvy Corp made sufficient
Discuss the facts from that case, the court''s reasoning : Discuss the facts from that case, the court's reasoning, and its ruling. Apply the relevant Cogdon facts to the case you discussed

Reviews

Write a Review

Business Law and Ethics Questions & Answers

  Legal environment of business caselet

The assignment in Law deals with the topic "Legal Environment of Business". A case study about Mary, a newly joined employee who is working in the USA and Europe. She faces few issues at her work place in Europe and tries to talk to her manager who s..

  Business ethics & legal issues caselet

This assignment is about the concept of Business Ethics & Legal Issues. The laws relating to these can be found in Antitrust laws. These laws are concerned with those large corporations which have a majority of market share, mergers and acquisitions.

  Questions on business law and ethics

Examples of securities that are exempted from the registration provisions of the 1933 Act and involving misstatement of material facts in a prospectus.

  Discuss the doctrine of ratification of pre-incorporation

With the aid of a decided cases, discuss the doctrine of ratification of pre-incorporation contract.

  Discuss the extent of phoenixing activity

It has been estimated that about 6,000 phoenix companies operate in Australia, costing government and the community hundreds of millions of dollars per year and impacting on individuals.

  Application of law to facts

Company Law, Application of Law to Facts and Conclusion.

  Question on business law and ethics

This assignment related to business law.

  Questions on business law

Answer all the questions under business law.

  Iidentify the issue raised by the facts

Iidentify the issue(s) raised by the facts, identify the relevant legal principles, apply the relevant legal principles to the facts, reach a conclusion.

  Evaluation of software development

Prepare a report and present an evaluation of the subsequent methodologies for software development in terms of cost, resources and time.

  Business value and ethics

Business value and ethics,  Bart agrees to put Sam's Super Bowl champion-ship autographed football in his sports store to sell for $1,500. Sam agrees to pay Bart a 15% commission for selling the ball. If Joe comes in the sports store and offers Bart ..

  Explain what is meant by income by ordinary concepts

Advise what tax consequences arise in respect of the payments.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd