Discuss the main dimensions for classification

Assignment Help Other Subject
Reference no: EM133208927

Question -

1. Discuss the main dimensions for classification of networked e-business.

2. Describe the BOAT framework and discuss the possible ways in which these aspects are related to each other.

3. Discuss the main business directions and operations related to networked e-business.

4. Discuss the role of service orientation for the architecture aspect of networked e-business.

5. Discuss how the main IT-based developments in the networked e-business domain (the Big Five) are related to the various technology classes.

6. Discuss the concept of strategic business-IT alignment and how it relates to the BOAT framework.

7. Discuss the tension field between separation and integration of concerns when analyzing or designing e- Business scenarios.

Reference no: EM133208927

Questions Cloud

Write a set of at least four ethical behaviours : Write a set of at least four ethical behaviours that you intend to abide by in your work as a real estate agent, based on your knowledge
What secondary structure is typically bound : What secondary structure is typically bound by the translocon during co-translational transport but is not cleaved by a signal peptidase
Discuss whether the decision to build the factory : Discuss whether the decision to build the factory at Kampung Melur is considered as ethical or unethical by applying Utilitarianism and Kantian Theory
Explain the evidence for evolution : Explain the evidence for evolution? What evidence did Darwin use to explain his theory of evolution? What do we know today that we didn't know then
Discuss the main dimensions for classification : Discuss the main dimensions for classification of networked e-business. Discuss the main business directions and operations related to networked e-business
What amino acid sequence will be generated : What amino acid sequence will be generated based on this strand of DNA? Use Figure 16.6 in your text book 3TACCGCTTACTGAAAGTTATT
Advise jackie on the sale of the farm house : The second issue she is having is regarding a rental property that she owns. Advise Jackie on the sale of the farm house
Apply the relevant cogdon facts to the case you discussed : Discuss the facts from that case, the court's reasoning, and its ruling. Apply the relevant Cogdon facts to the case you discussed
Explain what strict liability means in criminal law : Explain what strict liability means in criminal law. Support your explanation with a primary authority or a secondary scholarly source from Westlaw

Reviews

Write a Review

Other Subject Questions & Answers

  Discuss the content of the art work

Imagine you are being asked to create an online gallery with two works of art from the art movements we studied this week. The art examples do not have to be.

  What social justice means in education

Explain what social justice means in education and in your role as a future educator.

  Define two basic coping strategies for dealing with stress

Briefly define the two basic coping strategies for dealing with stress and give a brief example of how you use, or could use, these in your personal life.

  Job with freedonia publishing

Johanna applied for a job with Freedonia Publishing, a public company that oversees 7 newspapers across the United States

  Did capitalism emerge in the city or the countryside

1. Did capitalism emerge in the city or the countryside? What ‘social property relations' were necessary for the development of capitalism?

  Give a brief explanation of the burden of proof

Give a brief explanation of the burden of proof, which is proof beyond a reasonable doubt in a criminal prosecution. Give a brief explanation of prima facie. Give a brief explanation of the applicable code the prosecution was brought under

  Discuss incidence rates and causes for each disorder

Write a 1,500- to 1,750-word paper on the following: Describe one neurodevelopmental disorder and one neurocognitive disorder. Discuss incidence rates and causes for each disorder

  What does each author say about the breakdown

What does each author say about this breakdown? What are the key narrative moments that mark this breakdown in each author's memoir?

  Examine the company profiles of employers in local market

Examine the company profiles of three employers in your local market (provided by your instructor). Reflect on the qualities these potential employers.

  Compare the use of essay and short story

In two paragraphs, compare and contrast the use of essay and short story to convey the theme of the role of "wife" in the context of family and community.

  Millennium development goals

Millennium Development Goals

  What kinds of classifications do you think the supreme

what kinds of classifications do you think the supreme court should examine based on the 14th amendment? are there any

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd