What secondary structure is typically bound

Assignment Help Biology
Reference no: EM133208930

Question: What secondary structure is typically bound by the translocon during co-translational transport but is not cleaved by a signal peptidase and is deposited into the hydrophobic region of membrane?

1. beta-sheet

2. N- terminal hydrophobic signal sequences

3. alpha helices

4. glycolipids

Reference no: EM133208930

Questions Cloud

What is speciation : What is speciation- A new plant or animal species is developed through speciation. When a group within a species separates from other members of its species
How does chronic hypoxemia lead to polycthemia : How does chronic hypoxemia lead to polycthemia and What effects do hypoxic vasoconstriction and polycythemia have on the circulatory system
How many cells were plated on all 4 plates : How many cells were plated on all 4 plates? How many colonies total? Thus how many DNA molecules were able to transform those cells
Write a set of at least four ethical behaviours : Write a set of at least four ethical behaviours that you intend to abide by in your work as a real estate agent, based on your knowledge
What secondary structure is typically bound : What secondary structure is typically bound by the translocon during co-translational transport but is not cleaved by a signal peptidase
Discuss whether the decision to build the factory : Discuss whether the decision to build the factory at Kampung Melur is considered as ethical or unethical by applying Utilitarianism and Kantian Theory
Explain the evidence for evolution : Explain the evidence for evolution? What evidence did Darwin use to explain his theory of evolution? What do we know today that we didn't know then
Discuss the main dimensions for classification : Discuss the main dimensions for classification of networked e-business. Discuss the main business directions and operations related to networked e-business
What amino acid sequence will be generated : What amino acid sequence will be generated based on this strand of DNA? Use Figure 16.6 in your text book 3TACCGCTTACTGAAAGTTATT

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd