1 what did the astronomer edwin hubble discover about

Assignment Help Science
Reference no: EM13584314

1) What did the Astronomer Edwin Hubble discover about galaxies in the 1920's?

2) What formula is used to calculate the Hubble Parameter? Tell what each thing in the formula is.

4) Are the distances to galaxies given by Hubble's Law very accurate measurements like a spectroscope, a rough estimate like the distance to the distance to the Pleiades or something in between like the distances measured in the parallax lab?

5) Extra Credit: What else (other than the distance to far-away galaxies) can we learn from using Hubble's Law?

Reference no: EM13584314

Questions Cloud

David oliver and umar ansari with capital balances of 28000 : david oliver and umar ansari with capital balances of 28000 and 35000 respectively decide to liquidate their
Compute the gross margin ratio both with and without : use the following selected data from success systems income statement for the three months ended march 31 2014 and from
Why are frameshift mutations insertions and deletions more : 1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of
The company declared dividends of 6000 on preferred stock : burke company shows the following condensed income statement information for the year ended december 31 2010income
1 what did the astronomer edwin hubble discover about : 1 what did the astronomer edwin hubble discover about galaxies in the 1920s?2 what formula is used to calculate the
Give an example of a researchstatistic study that you : give an example of a researchstatistic study that you encountered this week in your life outside of this course. this
Johnson inc owns control over kaspar inc johnson reports : johnson inc. owns control over kaspar inc johnson reports sales of 400000 during 2013 while kaspar reports 250000.
Using the internet or strayer databases research the : each state within the united states has its own unique judicial selection process within its own court system.using the
Large corporation acquired and placed in service the : large corporation acquired and placed in service the following 100 business-use assets. large did not elect sec. 179

Reviews

Write a Review

Science Questions & Answers

  Direct seeding is a better

Direct seeding is a better way to conserve our soil which is, after all, a non-renewable resource. Direct seeding farmers are true stewards of the land.

  Analyze business planning based on an analysis of domestic

read the case study titled revitalizing a brand located in the online course shell. use the internet or strayer

  Describe the scientific and technical concepts associated

discussion-the promises and perils of nuclear powerthe term nuclear power refers to the production of electrical energy

  What is the difference between presidentialism and thatcheri

What is the difference between Presidentialism and Thatcherism?

  Write a research report based on a hypothetical research

write a research report based on a hypothetical research study. conducting research and writing a report is common

  Capacity of the efficiency of healthcare

Criteria audit can be referred as a quality enhancement cycle comprising capacity of the efficiency of healthcare towards decided and demonstrated standards for high quality.

  To eliminate experimental bias based

In explaining the study to the physicians and nurses who will participate , what steps should the researcher take to eliminate experimental bias based on both experimenter expectations and participant expectations.?

  Explain how variables such as social interaction

Explain how variables such as social interactions, cognitive processes, environmental variables, cultural context, and biological factors shape social psychology and how it is practiced.

  Personal barriers to critical thinking

Identify and briefly describe several general categories of personal barriers to critical thinking.

  What is neuronal plasticity

What is neuronal plasticity? Describe at least 4 pieces of evidence demonstrating that there is significant neuronal plasticity in adulthood, at least with some cortical functions.

  The role of the family physician is to assist the family in

annotated bibliography- stages of change modelbosworth olsen amp zimmerman march 1 2000. american academy of family

  Question 1a describe the impact of man on the environment

question 1a describe the impact of man on the environment with reference to the use of pesticides artificial

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd