Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
1. The following series of nucleotide bases forms part of a DNA molecule: TACTTATGACACAGGAGGACT
(a) Convert this string of bases into the bases that would be found on the corresponding mRNA molecule (transcription).
(b) Convert your answer from (a) into codons, and then list the string of amino acids that they code for (translation).
(c) Suppose that the 4th "T" on the original DNA sequence (underlined) is changed to a "G" by a point mutation. How is the resulting string of amino acids changed?
(d) Suppose that the last "G" on the original DNA sequence (underlined) is changed to a "C" by a point mutation. How is the resulting string of amino acids changed?
(e) Suppose that an extra "C" is inserted into the original DNA sequence after the 1st "C" (underlined). How is the resulting string of amino acids changed?
(f) Suppose that the 31d "A" on the original DNA sequence (underlined) is deleted. How is the resulting string of amino acids changed?
(g) Why are frameshift mutations (insertions and deletions) more likely to produce changes in an organism than a point mutation?
The R form of an allosteric enzyme:
apply the alara concept for worker protection during replacement of a pump in a system where removable contamination
Briefly explain four different evidences of evolution of modern day organisms from a common ancestor. Present these ideas with an approximate timeline of major evolutionary events.
Suppose that a series of compounds has been found in Neurospora . Compounds A-F appear to be members of an enzyme pathway.
eukaryotic cells in plants animals fungi and algae are bigger than prokaryotic bacterial cells. this bigger size allows
It is often proposed that a feature that is advantageous to individual organisms is the reason for the great number of species in certain clades.
A girl developed generalized seizures
Suppose a membrane potential of -70mV, what are two reasons why the electrochemical gradient for Ca2+ ([10-7 mM] free in the cytoplasm
This question concerns three E. coli genes. Genes a and b eachencode polypeptides of 300 amino acids, while gene cencodes a polypeptide of 3,000 amino acids.
Explain how you would prepare 200 ML of a 0.25 Msoluation of NaOH from a 3 M stock solution?
How a biologist would explain how ability to run fast evolved in cheetahs, assume their ancestors would only run 20 miles per hour. How various total depurinations in your body each day.
a human red blood cell has a membrane surface area of about 81microm2 and a membrane thickness of about 110 aordm. if
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd