Determine the molecular function, Biology

Assignment Help:

Please answer the following three questions on Sequence Z:

Metadata

The GO Ontology is a very widely-used resource in the bioinformatics community as a tool to annotate genes and their products. Websites serving genome databases such as TAIR use GO to annotate genes and other biological entities to enrich the data stored within by using semantic metadata.

1. BLAST Sequence Z into TAIR - from which gene does this sequence derive?

2. What are the Molecular Function terms that this gene is thought to have?

3. What are the GO IDs for these terms?

4. How do you think that biologists can benefit from the annotation of biological data with metadata in an ontology such as GO?

5. How could a bioinformatician exploit metadata such as GO terms programmatically?

Perl scripting

BLAST Sequence Z into EMBL-Bank and retrieve the flat file (Text view) output of the record. Then write a Perl script to read in the flat file and to write out the following fields:

1. The Accession Number for this record

2. The Description of the entry

3. Any Database Cross-references to InterPro records (i.e. InterPro Accession Numbers)

4. The Protein ID in the Feature Table

5. The length (in base pairs) of the nucleotide sequence

Please append your code to your coursework script.

Microarray databases

1. Which is the Affymetrix probe ID of this gene?

2. Using Genevestigator, answer the following:

  • In which developmental stage is the expression of this gene at it's highest?
  • In which part of the root does this gene typically exhibit higher expression:

   The lateral root or the endodermis?

3. Explain what criteria other than co-expression you'd want to use in order to be convinced that two or more genes are truly transcriptionally co-regulated?

4. Name two uses of microarray technology apart from transcriptomics. Briefly describe (1/3 page each) each technique.

Here is a coding sequence in fasta format:

>Sequence Z

ATGTGGAGGCTGAGAACTGGACCGAAGGCTGGAGAGGATACTCACCTGTTCACCACCAAC

AACTATGCAGGGAGGCAGATTTGGGAATTTGATGCCAACGCAGGCTCTCCACAAGAAATT

GCCGAGGTAGAGGATGCTCGGCACAAATTCTCAGACAACACGTCACGTTTCAAGACTACT

GCCGATCTCTTATGGCGCATGCAGTTTCTTAGGGAGAAGAAATTCGAACAGAAGATTCCA

CGAGTGATAATCGAGGATGCAAGAAAGATAAAGTACGAAGATGCAAAGACAGCATTGAAA

AGAGGGTTACTCTATTTCACAGCCTTGCAGGCTGATGATGGACACTGGCCAGCTGAAAAC

TCTGGCCCAAATTTCTATACCCCTCCTTTTTTGATATGCTTGTACATCACTGGACATCTG

GAGAAAATCTTCACTCCCGAGCATGTTAAAGAGTTACTACGTCACATCTACAACATGCAG

AACGAAGATGGTGGGTGGGGTTTACACGTAGAAAGCCACAGTGTTATGTTCTGTACAGTC

ATTAATTACGTCTGTCTACGAATTGTGGGAGAAGAAGTCGGTCATGATGATCAAAGAAAT

GGTTGTGCAAAGGCTCATAAGTGGATCATGGACCATGGTGGTGCTACCTACACGCCCTTG

ATCGGAAAAGCGTTGCTTTCGGTTCTTGGAGTGTATGATTGGTCTGGCTGCAATCCTATA

CCTCCAGAGTTCTGGTTGCTTCCGTCTTCTTTTCCTGTTAATGGAGGGACTCTCTGGATT

TATTTACGGGATACTTTCATGGGGTTGTCATACTTGTATGGTAAAAAATTTGTGGCTCCC

CCAACACCTCTCATTCTCCAGCTCCGAGAAGAGCTTTATCCGGAGCCTTATGCAAAAATC

AATTGGACGCAAACACGAAACCGATGTGGAAAGGAAGATCTCTACTATCCACGCTCATTT

TTACAAGATTTGTTTTGGAAGAGTGTTCACATGTTCTCAGAGAGTATCCTAGATCGATGG

CCTTTAAACAAGCTAATAAGACAAAGAGCTCTTCAATCCACTATGGCACTCATTCACTAT

CATGACGAATCCACCAGATATATTACAGGCGGATGCCTGCCAAAGGCCTTTCATATGCTT

GCATGTTGGATAGAAGACCCTAAGAGTGATTATTTTAAAAAACATCTTGCTCGAGTTCGC

GAATACATATGGATTGGCGAGGATGGCCTGAAAATTCAATCTTTTGGTAGCCAATTATGG

GATACAGCCTTATCGCTACATGCATTACTAGACGGAATTGATGATCATGATGTTGATGAT

GAGATTAAAACAACGCTCGTTAAAGGATATGATTACTTGAAGAAATCACAAATTACAGAG

AACCCTCGCGGTGATCACTTCAAAATGTTTCGTCACAAGACAAAAGGTGGATGGACATTT

TCAGATCAAGATCAAGGATGGCCTGTTTCAGATTGTACTGCTGAAAGCTTAGAGTGTTGT

CTATTCTTCGAGAGCATGCCGTCCGAGCTTATTGGAAAAAAAATGGATGTGGAGAAACTC

TATGATGCCGTTGATTATCTTCTCTATCTGCAGAGTGATAATGGAGGCATAGCAGCATGG

CAACCAGTTGAAGGAAAAGCCTGGTTAGAGTTGTTAAATATCATGATTTTTAGGTATGTA

GAATGTACGGGGTCAGCGATTGCAGCATTGACTCAGTTTAACAAACAGTTTCCAGGGTAT

AAAAACGTAGAGGTTAAACGGTTTATAACAAAGGCTGCAAAGTACATTGAAGACATGCAA

ACGGTGGATGGTTCATGGTACGGAAATTGGGGAGTGTGTTTTATATACGGGACCTTCTTT

GCGGTAAGAGGTCTTGTGGCCGCTGGGAAGACTTACAGTAACTGTGAAGCAATTCGTAAA

GCAGTTCGTTTTCTTCTAGACACACAAAATCCGGAGGGTGGCTGGGGAGAGAGCTTTCTC

TCTTGTCCAAGCAAGAAATATACTCCTTTGAAAGGAAACAGCACAAATGTGGTGCAAACA

GCACAAGCACTTATGGTGCTAATTATGGGTGATCAGATGGAGAGAGATCCTTTACCGGTT

CATCGTGCTGCTCAAGTGTTGATCAATTCACAGTTGGATAATGGCGATTTTCCACAGCAG

GAAATAATGGGAACGTTCATGAGAACTGTGATGCTCCATTTTCCGACCTATAGGAACACG

TTCTCTCTTTGGGCTCTCACACATTACACACATGCTCTGCGACGTCTCCTCCCTTAA

 


Related Discussions:- Determine the molecular function

Mention the main cause of air pollution in metro cities, a) Mention the mai...

a) Mention the main cause of air pollution in metro cities. Write any three ways by which it can be decreased. b) How did Eli Lilly synthesize the human insulin? Mention

Multidisciplinary approach to solving nutrition problems, Define Multidisci...

Define Multidisciplinary Approach to Solving Nutrition Problems? You must have realized by now that solving public nutrition problems represents a multidisciplinary challenge o

Classification of microorganisms, Q. Classification of microorganisms? ...

Q. Classification of microorganisms? The microorganisms use our food as a source of nutrients for their own growth. This, of course can result in deterioration of the food. By

Explain hepatitis c, Hepatitis C It provides sustained viral responses ...

Hepatitis C It provides sustained viral responses (SVRs) of 54% to 63%. When used as monotherapy, peginterferons once weekly are more effective than standard interferon 3 times

What are the reticular fibers of the connective tissue, Q. What are the ret...

Q. What are the reticular fibers of the connective tissue and where they can be found? The reticular fibers are especially delicate interstitial fibers made of a special kind o

Which of following is not true regarding the immune response, Which of the ...

Which of the following is not true regarding the immune response? Answer The immune response uses chemical and phagocytic cells to destroy foreign cells. Once initiated, the immune

What are trends of the gametophyte in the evolution of plant, What are tren...

What are trends of the gametophyte in the evolution of plants? The tendency of the gametophyte evolution in plants has been towards the formation of gametes that are self-dete

Why are we not inundated with bacterial infections, We are told that every ...

We are told that every surface we touch is teeming with bacterial cells, and bacteria are found in the pools we swim in, the water we wash with, and on the hands of friends. Why ar

What is sodium-potassium pump, Sodium-potassium pump A. The net flux of...

Sodium-potassium pump A. The net flux of sodium is from a region of high sodium concentration to a region of low sodium concentration. B. The net flux of potassium is from a

Hydrogen bonds important for making water cohesive liquid, Hydrogen bonds a...

Hydrogen bonds are important for all of the following except:: a) Allowing carbohydrates to dissolve in water b) Stabilizing the three-dimensional shape of proteins. c) Ma

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd