Determine the accession number for the related gene-locus, Biology

Please answer the following two questions on Sequence X:

1) DNA sequence databases

1. What is the EMBL-Bank accession number for this sequence (use BLAST)?

2. Which gene does this sequence code for?

3. In which taxonomic division and species does this sequence derive from?

4. How many TATA signals are in the promoter region of this gene and what are their co-ordinates? Are the TATA box sequences identical?

5. What database cross-references exist for this sequence?

2) Genome databases

1. What would be an appropriate genome database for the species from which this sequence derives?

2. What is the accession number for the related gene/locus in that genome database?

3. On what chromosome is this gene located?

4. What are Standard Names and the Systematic Names of the upstream and downstream (neighbouring) genes for this gene?

Here is a nucleotide sequence in fasta format:

>Sequence X

tcgagggtatctcttatcggtattactttcttatcaatgaaaaatttctgccagggaaaa

tgcgcccgctttttttccggccatccttactcgctgtcgcatacaaaatagcgcctctaa

tctagttgcgataaggaatgtgtatgtgtaattgaagatccaggatgttttccttttcag

ggagatgagaaggaataataggatggattgaccgctttgctgtcacgtcgataaggttcc

tttaaagattgtgtccaatgattagcatagagaggtagagtatcagagaaacaagtttgt

aatcgagaaacttgatctgctagtgttgagcatagaaggctaggaaaacatggggaagaa

aaaaaaagtataaataattagcttgatgagtagtttgaatatatatgttactttagtttc

cctttttgaccttttatattcatctacatcttgtgatataaaacatcaacaaagacgaga

atggctaacgacgctctaagtgctattttcagtaatccttcgaggaaaggtgtccaaccc

tccacatctattgtgtcatatacaaacaatgaagatgatattatagatgtggaaaatggg

aagttcaacaagaacaagaatatcaacactaatgtgtatgtggacaactcctcaatagag

gagagcgaagtcgtgcccttgcccgaaacaaagtccatctggagtaaaatatactacgat

ttcattgtgttagacaagacaactttgaatgtttcgttgaaagagtcgttcttgtataac

agagacttgaaaccggttgaagaagaaagaaggtgttggtcctggttcaattacttatat

ttctggctggcagactgtttcaatattaacacatggcaaatagctggtacaggtctacaa

ctaggtctgaattggtggcaatgttggcttacagtttggatcggctacacttttgcaggt

atcttcgtagtattgaactcgagatttggttccgcatatcacttatctttccctattact

gttagggcctcatttggtatattcttttctatgtggccgattataaatcgtgtcgtgatg

gctatagtatggtatgccgtgcaagcctggttaggtgcaacgcccgtggcactgatgcta

aaatctatttttggcaagaatctggaagatagaatcccaaaccattttggttctccaaat

agcactacttttgaattcatgtgtttctttatattttgggtggtcagtataccatttgtc

ctagtggctcctcataaaatcaggcatttattcacagtaaaagcagctttgatccccttc

gcagcctttggatttttaatctgggctttgaagaaatcgcacggtaaaattgagttgggg

acgctgaatgattattcacctcatggttccgaattttcatggatattcgttagatcccta

atggcctgtgttgctaactttgccgctttgattatcaacgcccctgacttcggtagattt

gccaaaaatcctcaagcgtctttgtggccacaattggttgccatcccattgttcttcgcc

ataacatgtttgatcggtatcattgttactgcggccggttatcacttatatggggttaac

tattggtcaccactggatgtacttggtcaatttttggagaccacttacaccagaggtact

agggctggtgtgttcttgatttcttttgtatttgccttagctcaactgggtacaaacatt

tctgccaactctctggcatgtggtgctgatatgacggctttgtttccaagatatattaat

attagaagaggttctttattctgtgtggcaatggctctatgtatctgtccatggaactta

atggccagttcaagtaagttcaccagcgctttgggtgcttatgcaattttcctttccagt

attgctggtgtcatttgcgcggattatttcgtagtaagaagaggatatgtgaaattaaca

catttattcctggcacagaagggttccttttacatgtttggaaacaaatttggtgccaat

tggagggcctttgttgcgtatatttgcggtatcgctccaaatttaccaggttttataggt

gatgttggagctccaaaaattacggtttcagagggtgcaatgaggttatactatttaggt

tatccggtaggtttctttattagtgcggtgatatacctcatattatgttacttttttcct

gtccctggtactcccgtaaccaattttctgacagagaaaggatggttccaaagatgggct

tatgttgaggacttcgagcaagattggaagaatgagttacgtagggatgacctctgcgat

gacacagtcagtatctatgatggcaccgaggaaaagatagtttactaaataaaaatccca

atttattctcttaccagtagtgatcaggagaattgataatttcttcaaaacaccttaata

ttcgttctgtgtatttttatgtacctttcttaatcaaatttatcagcttcatacatgcat

tcccgtctgaataatgtactgatgattagctaaaccgtcatcaacctaccaaacttgcgc

ttgtttgagcctatcagaactccggataattccgacatcttatctttgact

 

Posted Date: 3/7/2013 5:24:41 AM | Location : United States







Related Discussions:- Determine the accession number for the related gene-locus, Assignment Help, Ask Question on Determine the accession number for the related gene-locus, Get Answer, Expert's Help, Determine the accession number for the related gene-locus Discussions

Write discussion on Determine the accession number for the related gene-locus
Your posts are moderated
Related Questions
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Q. What is Pulmonary Veins in Normal Pulmonary Vasculature? The right and left upper lobe or superior pulmonary veins descend lateral to the arteries, cross in front of the hil

Lipids are essential fats that have much importance to the human body. Lipids are biological molecules that are insoluble in aqueous solutions and soluble in organic solvents are c

What is meningitis? Meningitis is the generic name given to inflammation of the meninges, membranes that cover the central nervous system. Meningitis can have various causes (i

What key idea, contained in Malthus's essay on populations, helped Darwin formulate his theory of natural selection?

differentiate between scanning electron microscope and a transmission electron microscope in terms of their functions


Various proteins are free to take a move laterally in the plane of the bilayer. One experiment used to represent this included fusing cultured mouse cells with human cells under ap

Dendrology : This is the study of all kinds of trees. Dendrology we can also say it xylology it is the science or study of wooded plants like trees, shrubs, and lianas. There is no

Hydrops allantois (Hydro allantois) This condition is uncommonly seen in dairy cattle and buffaloes. Accumulation of excessive allantoic fluid may be progressive after mid ges