Determine the accession number for the related gene-locus, Biology

Please answer the following two questions on Sequence X:

1) DNA sequence databases

1. What is the EMBL-Bank accession number for this sequence (use BLAST)?

2. Which gene does this sequence code for?

3. In which taxonomic division and species does this sequence derive from?

4. How many TATA signals are in the promoter region of this gene and what are their co-ordinates? Are the TATA box sequences identical?

5. What database cross-references exist for this sequence?

2) Genome databases

1. What would be an appropriate genome database for the species from which this sequence derives?

2. What is the accession number for the related gene/locus in that genome database?

3. On what chromosome is this gene located?

4. What are Standard Names and the Systematic Names of the upstream and downstream (neighbouring) genes for this gene?

Here is a nucleotide sequence in fasta format:

>Sequence X

tcgagggtatctcttatcggtattactttcttatcaatgaaaaatttctgccagggaaaa

tgcgcccgctttttttccggccatccttactcgctgtcgcatacaaaatagcgcctctaa

tctagttgcgataaggaatgtgtatgtgtaattgaagatccaggatgttttccttttcag

ggagatgagaaggaataataggatggattgaccgctttgctgtcacgtcgataaggttcc

tttaaagattgtgtccaatgattagcatagagaggtagagtatcagagaaacaagtttgt

aatcgagaaacttgatctgctagtgttgagcatagaaggctaggaaaacatggggaagaa

aaaaaaagtataaataattagcttgatgagtagtttgaatatatatgttactttagtttc

cctttttgaccttttatattcatctacatcttgtgatataaaacatcaacaaagacgaga

atggctaacgacgctctaagtgctattttcagtaatccttcgaggaaaggtgtccaaccc

tccacatctattgtgtcatatacaaacaatgaagatgatattatagatgtggaaaatggg

aagttcaacaagaacaagaatatcaacactaatgtgtatgtggacaactcctcaatagag

gagagcgaagtcgtgcccttgcccgaaacaaagtccatctggagtaaaatatactacgat

ttcattgtgttagacaagacaactttgaatgtttcgttgaaagagtcgttcttgtataac

agagacttgaaaccggttgaagaagaaagaaggtgttggtcctggttcaattacttatat

ttctggctggcagactgtttcaatattaacacatggcaaatagctggtacaggtctacaa

ctaggtctgaattggtggcaatgttggcttacagtttggatcggctacacttttgcaggt

atcttcgtagtattgaactcgagatttggttccgcatatcacttatctttccctattact

gttagggcctcatttggtatattcttttctatgtggccgattataaatcgtgtcgtgatg

gctatagtatggtatgccgtgcaagcctggttaggtgcaacgcccgtggcactgatgcta

aaatctatttttggcaagaatctggaagatagaatcccaaaccattttggttctccaaat

agcactacttttgaattcatgtgtttctttatattttgggtggtcagtataccatttgtc

ctagtggctcctcataaaatcaggcatttattcacagtaaaagcagctttgatccccttc

gcagcctttggatttttaatctgggctttgaagaaatcgcacggtaaaattgagttgggg

acgctgaatgattattcacctcatggttccgaattttcatggatattcgttagatcccta

atggcctgtgttgctaactttgccgctttgattatcaacgcccctgacttcggtagattt

gccaaaaatcctcaagcgtctttgtggccacaattggttgccatcccattgttcttcgcc

ataacatgtttgatcggtatcattgttactgcggccggttatcacttatatggggttaac

tattggtcaccactggatgtacttggtcaatttttggagaccacttacaccagaggtact

agggctggtgtgttcttgatttcttttgtatttgccttagctcaactgggtacaaacatt

tctgccaactctctggcatgtggtgctgatatgacggctttgtttccaagatatattaat

attagaagaggttctttattctgtgtggcaatggctctatgtatctgtccatggaactta

atggccagttcaagtaagttcaccagcgctttgggtgcttatgcaattttcctttccagt

attgctggtgtcatttgcgcggattatttcgtagtaagaagaggatatgtgaaattaaca

catttattcctggcacagaagggttccttttacatgtttggaaacaaatttggtgccaat

tggagggcctttgttgcgtatatttgcggtatcgctccaaatttaccaggttttataggt

gatgttggagctccaaaaattacggtttcagagggtgcaatgaggttatactatttaggt

tatccggtaggtttctttattagtgcggtgatatacctcatattatgttacttttttcct

gtccctggtactcccgtaaccaattttctgacagagaaaggatggttccaaagatgggct

tatgttgaggacttcgagcaagattggaagaatgagttacgtagggatgacctctgcgat

gacacagtcagtatctatgatggcaccgaggaaaagatagtttactaaataaaaatccca

atttattctcttaccagtagtgatcaggagaattgataatttcttcaaaacaccttaata

ttcgttctgtgtatttttatgtacctttcttaatcaaatttatcagcttcatacatgcat

tcccgtctgaataatgtactgatgattagctaaaccgtcatcaacctaccaaacttgcgc

ttgtttgagcctatcagaactccggataattccgacatcttatctttgact

 

Posted Date: 3/7/2013 5:24:41 AM | Location : United States







Related Discussions:- Determine the accession number for the related gene-locus, Assignment Help, Ask Question on Determine the accession number for the related gene-locus, Get Answer, Expert's Help, Determine the accession number for the related gene-locus Discussions

Write discussion on Determine the accession number for the related gene-locus
Your posts are moderated
Related Questions
What are the four characteristics that all chordates have at some stage of their lifecycle ?

What is Mitochondria ? Mitochondria are the cellular organelles responsible for the conversion of energy into a form called ATP. ATP is a high energy chemical compound that cel

Subphylum Trilobitomorpha Subphylum Trilobitomorpha involves the trilobites. All species are extinct and the fossils point out that they were all marine forms belonging to Pal

Explain Human Development? Human development begins with fertilization, and continues throughout life. Fertilization occurs when two sex cells, a sperm cell and an egg cell, jo

Define the symptoms in Bone marrow of pernicious anaemia? The nucleated red cells of the marrow are greatly increased.  The successive nucleated cell stages in erythropoiesis a

Explain about Regenerative therapy   Is also used to achieve the above objectives but with the ultimate goal of regeneration of lost bone tissue.

Explain the Primary Treatment for Managing Food Allergies? The primary treatment for managing food allergies is eliminating the offending food or foods. In fact, non-pharmacolo

Dinitrophenol, DNP, was prescribed in low doses in the 1940's to help obese patients lose weight. It's use for this purpose was discontinued when several users died. DNP makes the

why excretory organ of prawn is called green gland?

brief account on classification and general characters of protozoa