Determine the accession number for the related gene-locus, Biology

Please answer the following two questions on Sequence X:

1) DNA sequence databases

1. What is the EMBL-Bank accession number for this sequence (use BLAST)?

2. Which gene does this sequence code for?

3. In which taxonomic division and species does this sequence derive from?

4. How many TATA signals are in the promoter region of this gene and what are their co-ordinates? Are the TATA box sequences identical?

5. What database cross-references exist for this sequence?

2) Genome databases

1. What would be an appropriate genome database for the species from which this sequence derives?

2. What is the accession number for the related gene/locus in that genome database?

3. On what chromosome is this gene located?

4. What are Standard Names and the Systematic Names of the upstream and downstream (neighbouring) genes for this gene?

Here is a nucleotide sequence in fasta format:

>Sequence X

tcgagggtatctcttatcggtattactttcttatcaatgaaaaatttctgccagggaaaa

tgcgcccgctttttttccggccatccttactcgctgtcgcatacaaaatagcgcctctaa

tctagttgcgataaggaatgtgtatgtgtaattgaagatccaggatgttttccttttcag

ggagatgagaaggaataataggatggattgaccgctttgctgtcacgtcgataaggttcc

tttaaagattgtgtccaatgattagcatagagaggtagagtatcagagaaacaagtttgt

aatcgagaaacttgatctgctagtgttgagcatagaaggctaggaaaacatggggaagaa

aaaaaaagtataaataattagcttgatgagtagtttgaatatatatgttactttagtttc

cctttttgaccttttatattcatctacatcttgtgatataaaacatcaacaaagacgaga

atggctaacgacgctctaagtgctattttcagtaatccttcgaggaaaggtgtccaaccc

tccacatctattgtgtcatatacaaacaatgaagatgatattatagatgtggaaaatggg

aagttcaacaagaacaagaatatcaacactaatgtgtatgtggacaactcctcaatagag

gagagcgaagtcgtgcccttgcccgaaacaaagtccatctggagtaaaatatactacgat

ttcattgtgttagacaagacaactttgaatgtttcgttgaaagagtcgttcttgtataac

agagacttgaaaccggttgaagaagaaagaaggtgttggtcctggttcaattacttatat

ttctggctggcagactgtttcaatattaacacatggcaaatagctggtacaggtctacaa

ctaggtctgaattggtggcaatgttggcttacagtttggatcggctacacttttgcaggt

atcttcgtagtattgaactcgagatttggttccgcatatcacttatctttccctattact

gttagggcctcatttggtatattcttttctatgtggccgattataaatcgtgtcgtgatg

gctatagtatggtatgccgtgcaagcctggttaggtgcaacgcccgtggcactgatgcta

aaatctatttttggcaagaatctggaagatagaatcccaaaccattttggttctccaaat

agcactacttttgaattcatgtgtttctttatattttgggtggtcagtataccatttgtc

ctagtggctcctcataaaatcaggcatttattcacagtaaaagcagctttgatccccttc

gcagcctttggatttttaatctgggctttgaagaaatcgcacggtaaaattgagttgggg

acgctgaatgattattcacctcatggttccgaattttcatggatattcgttagatcccta

atggcctgtgttgctaactttgccgctttgattatcaacgcccctgacttcggtagattt

gccaaaaatcctcaagcgtctttgtggccacaattggttgccatcccattgttcttcgcc

ataacatgtttgatcggtatcattgttactgcggccggttatcacttatatggggttaac

tattggtcaccactggatgtacttggtcaatttttggagaccacttacaccagaggtact

agggctggtgtgttcttgatttcttttgtatttgccttagctcaactgggtacaaacatt

tctgccaactctctggcatgtggtgctgatatgacggctttgtttccaagatatattaat

attagaagaggttctttattctgtgtggcaatggctctatgtatctgtccatggaactta

atggccagttcaagtaagttcaccagcgctttgggtgcttatgcaattttcctttccagt

attgctggtgtcatttgcgcggattatttcgtagtaagaagaggatatgtgaaattaaca

catttattcctggcacagaagggttccttttacatgtttggaaacaaatttggtgccaat

tggagggcctttgttgcgtatatttgcggtatcgctccaaatttaccaggttttataggt

gatgttggagctccaaaaattacggtttcagagggtgcaatgaggttatactatttaggt

tatccggtaggtttctttattagtgcggtgatatacctcatattatgttacttttttcct

gtccctggtactcccgtaaccaattttctgacagagaaaggatggttccaaagatgggct

tatgttgaggacttcgagcaagattggaagaatgagttacgtagggatgacctctgcgat

gacacagtcagtatctatgatggcaccgaggaaaagatagtttactaaataaaaatccca

atttattctcttaccagtagtgatcaggagaattgataatttcttcaaaacaccttaata

ttcgttctgtgtatttttatgtacctttcttaatcaaatttatcagcttcatacatgcat

tcccgtctgaataatgtactgatgattagctaaaccgtcatcaacctaccaaacttgcgc

ttgtttgagcctatcagaactccggataattccgacatcttatctttgact

 

Posted Date: 3/7/2013 5:24:41 AM | Location : United States







Related Discussions:- Determine the accession number for the related gene-locus, Assignment Help, Ask Question on Determine the accession number for the related gene-locus, Get Answer, Expert's Help, Determine the accession number for the related gene-locus Discussions

Write discussion on Determine the accession number for the related gene-locus
Your posts are moderated
Related Questions
Q. Where is it produced and what is the function of secretin in the digestive process? Secretin is made in the duodenum the chyme acidity causes the duodenum to release this ho

Q. Give Choice of Catheters for Ventriculography? 1) Pigtail Catheter: This catheter developed by Judkins has end hole and side holes. The end hole permits insertion of the c

Q Which is the kind of nitrogen waste birds produce? Why does this feature, besides being an adaptation to the terrestrial environment, also mean an adaptation to flight? Birds

Certain conditions such as excessive alcohol consumption can increase the ratio of NADH/NAD+ in the mitochondria. This will directly inhibit which of the following enzymes? -cit

Cnidaria and Platyhelminthes - Larval forms Cnidaria The common larval stage that is found in cnidarians is the planula which forms following gastrulation. The planula is

Micrographia is abnormally small, cramped handwriting and/or the progression to continually smaller handwriting. This is one of the symptoms of Parkinson''s disease.

Q. Describe the process of Rodent control? Rats and mice are destructive and cause huge loss of stored food commodities. They transmit pathogenic bacteria. Rats and mice are ge

COPPER It is a trace element which is available in most of the fruits. Maximum in heart, brain, kidney & crustaceans. By its deficiency monkin's disease is caused. Cop

INTRODUCTION :  It took just hundred years for cardiac surgery to advance to what it is today. Before 1896, surgeons considered heart to be "inviolable" and it was stated that ope

What are Taxonomic characters Taxonomic characters Classification is done on the basis of information we have. More information gives better classification. Modern taxonomy