Determine the accession number for the related gene-locus, Biology

Please answer the following two questions on Sequence X:

1) DNA sequence databases

1. What is the EMBL-Bank accession number for this sequence (use BLAST)?

2. Which gene does this sequence code for?

3. In which taxonomic division and species does this sequence derive from?

4. How many TATA signals are in the promoter region of this gene and what are their co-ordinates? Are the TATA box sequences identical?

5. What database cross-references exist for this sequence?

2) Genome databases

1. What would be an appropriate genome database for the species from which this sequence derives?

2. What is the accession number for the related gene/locus in that genome database?

3. On what chromosome is this gene located?

4. What are Standard Names and the Systematic Names of the upstream and downstream (neighbouring) genes for this gene?

Here is a nucleotide sequence in fasta format:

>Sequence X

tcgagggtatctcttatcggtattactttcttatcaatgaaaaatttctgccagggaaaa

tgcgcccgctttttttccggccatccttactcgctgtcgcatacaaaatagcgcctctaa

tctagttgcgataaggaatgtgtatgtgtaattgaagatccaggatgttttccttttcag

ggagatgagaaggaataataggatggattgaccgctttgctgtcacgtcgataaggttcc

tttaaagattgtgtccaatgattagcatagagaggtagagtatcagagaaacaagtttgt

aatcgagaaacttgatctgctagtgttgagcatagaaggctaggaaaacatggggaagaa

aaaaaaagtataaataattagcttgatgagtagtttgaatatatatgttactttagtttc

cctttttgaccttttatattcatctacatcttgtgatataaaacatcaacaaagacgaga

atggctaacgacgctctaagtgctattttcagtaatccttcgaggaaaggtgtccaaccc

tccacatctattgtgtcatatacaaacaatgaagatgatattatagatgtggaaaatggg

aagttcaacaagaacaagaatatcaacactaatgtgtatgtggacaactcctcaatagag

gagagcgaagtcgtgcccttgcccgaaacaaagtccatctggagtaaaatatactacgat

ttcattgtgttagacaagacaactttgaatgtttcgttgaaagagtcgttcttgtataac

agagacttgaaaccggttgaagaagaaagaaggtgttggtcctggttcaattacttatat

ttctggctggcagactgtttcaatattaacacatggcaaatagctggtacaggtctacaa

ctaggtctgaattggtggcaatgttggcttacagtttggatcggctacacttttgcaggt

atcttcgtagtattgaactcgagatttggttccgcatatcacttatctttccctattact

gttagggcctcatttggtatattcttttctatgtggccgattataaatcgtgtcgtgatg

gctatagtatggtatgccgtgcaagcctggttaggtgcaacgcccgtggcactgatgcta

aaatctatttttggcaagaatctggaagatagaatcccaaaccattttggttctccaaat

agcactacttttgaattcatgtgtttctttatattttgggtggtcagtataccatttgtc

ctagtggctcctcataaaatcaggcatttattcacagtaaaagcagctttgatccccttc

gcagcctttggatttttaatctgggctttgaagaaatcgcacggtaaaattgagttgggg

acgctgaatgattattcacctcatggttccgaattttcatggatattcgttagatcccta

atggcctgtgttgctaactttgccgctttgattatcaacgcccctgacttcggtagattt

gccaaaaatcctcaagcgtctttgtggccacaattggttgccatcccattgttcttcgcc

ataacatgtttgatcggtatcattgttactgcggccggttatcacttatatggggttaac

tattggtcaccactggatgtacttggtcaatttttggagaccacttacaccagaggtact

agggctggtgtgttcttgatttcttttgtatttgccttagctcaactgggtacaaacatt

tctgccaactctctggcatgtggtgctgatatgacggctttgtttccaagatatattaat

attagaagaggttctttattctgtgtggcaatggctctatgtatctgtccatggaactta

atggccagttcaagtaagttcaccagcgctttgggtgcttatgcaattttcctttccagt

attgctggtgtcatttgcgcggattatttcgtagtaagaagaggatatgtgaaattaaca

catttattcctggcacagaagggttccttttacatgtttggaaacaaatttggtgccaat

tggagggcctttgttgcgtatatttgcggtatcgctccaaatttaccaggttttataggt

gatgttggagctccaaaaattacggtttcagagggtgcaatgaggttatactatttaggt

tatccggtaggtttctttattagtgcggtgatatacctcatattatgttacttttttcct

gtccctggtactcccgtaaccaattttctgacagagaaaggatggttccaaagatgggct

tatgttgaggacttcgagcaagattggaagaatgagttacgtagggatgacctctgcgat

gacacagtcagtatctatgatggcaccgaggaaaagatagtttactaaataaaaatccca

atttattctcttaccagtagtgatcaggagaattgataatttcttcaaaacaccttaata

ttcgttctgtgtatttttatgtacctttcttaatcaaatttatcagcttcatacatgcat

tcccgtctgaataatgtactgatgattagctaaaccgtcatcaacctaccaaacttgcgc

ttgtttgagcctatcagaactccggataattccgacatcttatctttgact

 

Posted Date: 3/7/2013 5:24:41 AM | Location : United States







Related Discussions:- Determine the accession number for the related gene-locus, Assignment Help, Ask Question on Determine the accession number for the related gene-locus, Get Answer, Expert's Help, Determine the accession number for the related gene-locus Discussions

Write discussion on Determine the accession number for the related gene-locus
Your posts are moderated
Related Questions
Define Tests for the Presence of Exoenzymatic Activity? Microorganisms require various micro- and macro-nutrients for energy production and growth. These are obtained from the

Immediate Post-operative Care The patient is accompanied to the ICU by a surgeon, anesthetist and the nurse who assisted for the surgery with portable ventilator and ECG

Define Absorption of Calcium from dietary calcium supplements? Absorption from dietary calcium supplements is important to know, since they are almost universally recommended f

Q. What are the main bryophyte groups? The major bryophyte groups are the mosses, the hornworts and the liverworts.

You have 875 mL of a 0.37 M acetic acid solution. What volume (V) of 1.20 M NaOH solution must you add in order to prepare an acetate buffer of pH = 4.36? (The pKa of acetic acid i

Explain Transfer from Solid Culture to Liquid Media The steps involved in this technique are included herewith: 1. Sterilized inoculating loop or needle is touched carefully

Determine about the Halstead's method Reitan adopted Halstead's methods and various test procedures and with them established a laboratory at the University of Indiana. He supp

Q. Why are euglenas involved in polemics related to their taxonomic classification? Euglenas are involved in taxonomic polemics because they tend to be classified sometimes as

#Is GMO food good as the prospective of the ethic values of the society?..

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4