Determine the accession number for the related gene-locus, Biology

Please answer the following two questions on Sequence X:

1) DNA sequence databases

1. What is the EMBL-Bank accession number for this sequence (use BLAST)?

2. Which gene does this sequence code for?

3. In which taxonomic division and species does this sequence derive from?

4. How many TATA signals are in the promoter region of this gene and what are their co-ordinates? Are the TATA box sequences identical?

5. What database cross-references exist for this sequence?

2) Genome databases

1. What would be an appropriate genome database for the species from which this sequence derives?

2. What is the accession number for the related gene/locus in that genome database?

3. On what chromosome is this gene located?

4. What are Standard Names and the Systematic Names of the upstream and downstream (neighbouring) genes for this gene?

Here is a nucleotide sequence in fasta format:

>Sequence X

tcgagggtatctcttatcggtattactttcttatcaatgaaaaatttctgccagggaaaa

tgcgcccgctttttttccggccatccttactcgctgtcgcatacaaaatagcgcctctaa

tctagttgcgataaggaatgtgtatgtgtaattgaagatccaggatgttttccttttcag

ggagatgagaaggaataataggatggattgaccgctttgctgtcacgtcgataaggttcc

tttaaagattgtgtccaatgattagcatagagaggtagagtatcagagaaacaagtttgt

aatcgagaaacttgatctgctagtgttgagcatagaaggctaggaaaacatggggaagaa

aaaaaaagtataaataattagcttgatgagtagtttgaatatatatgttactttagtttc

cctttttgaccttttatattcatctacatcttgtgatataaaacatcaacaaagacgaga

atggctaacgacgctctaagtgctattttcagtaatccttcgaggaaaggtgtccaaccc

tccacatctattgtgtcatatacaaacaatgaagatgatattatagatgtggaaaatggg

aagttcaacaagaacaagaatatcaacactaatgtgtatgtggacaactcctcaatagag

gagagcgaagtcgtgcccttgcccgaaacaaagtccatctggagtaaaatatactacgat

ttcattgtgttagacaagacaactttgaatgtttcgttgaaagagtcgttcttgtataac

agagacttgaaaccggttgaagaagaaagaaggtgttggtcctggttcaattacttatat

ttctggctggcagactgtttcaatattaacacatggcaaatagctggtacaggtctacaa

ctaggtctgaattggtggcaatgttggcttacagtttggatcggctacacttttgcaggt

atcttcgtagtattgaactcgagatttggttccgcatatcacttatctttccctattact

gttagggcctcatttggtatattcttttctatgtggccgattataaatcgtgtcgtgatg

gctatagtatggtatgccgtgcaagcctggttaggtgcaacgcccgtggcactgatgcta

aaatctatttttggcaagaatctggaagatagaatcccaaaccattttggttctccaaat

agcactacttttgaattcatgtgtttctttatattttgggtggtcagtataccatttgtc

ctagtggctcctcataaaatcaggcatttattcacagtaaaagcagctttgatccccttc

gcagcctttggatttttaatctgggctttgaagaaatcgcacggtaaaattgagttgggg

acgctgaatgattattcacctcatggttccgaattttcatggatattcgttagatcccta

atggcctgtgttgctaactttgccgctttgattatcaacgcccctgacttcggtagattt

gccaaaaatcctcaagcgtctttgtggccacaattggttgccatcccattgttcttcgcc

ataacatgtttgatcggtatcattgttactgcggccggttatcacttatatggggttaac

tattggtcaccactggatgtacttggtcaatttttggagaccacttacaccagaggtact

agggctggtgtgttcttgatttcttttgtatttgccttagctcaactgggtacaaacatt

tctgccaactctctggcatgtggtgctgatatgacggctttgtttccaagatatattaat

attagaagaggttctttattctgtgtggcaatggctctatgtatctgtccatggaactta

atggccagttcaagtaagttcaccagcgctttgggtgcttatgcaattttcctttccagt

attgctggtgtcatttgcgcggattatttcgtagtaagaagaggatatgtgaaattaaca

catttattcctggcacagaagggttccttttacatgtttggaaacaaatttggtgccaat

tggagggcctttgttgcgtatatttgcggtatcgctccaaatttaccaggttttataggt

gatgttggagctccaaaaattacggtttcagagggtgcaatgaggttatactatttaggt

tatccggtaggtttctttattagtgcggtgatatacctcatattatgttacttttttcct

gtccctggtactcccgtaaccaattttctgacagagaaaggatggttccaaagatgggct

tatgttgaggacttcgagcaagattggaagaatgagttacgtagggatgacctctgcgat

gacacagtcagtatctatgatggcaccgaggaaaagatagtttactaaataaaaatccca

atttattctcttaccagtagtgatcaggagaattgataatttcttcaaaacaccttaata

ttcgttctgtgtatttttatgtacctttcttaatcaaatttatcagcttcatacatgcat

tcccgtctgaataatgtactgatgattagctaaaccgtcatcaacctaccaaacttgcgc

ttgtttgagcctatcagaactccggataattccgacatcttatctttgact

 

Posted Date: 3/7/2013 5:24:41 AM | Location : United States







Related Discussions:- Determine the accession number for the related gene-locus, Assignment Help, Ask Question on Determine the accession number for the related gene-locus, Get Answer, Expert's Help, Determine the accession number for the related gene-locus Discussions

Write discussion on Determine the accession number for the related gene-locus
Your posts are moderated
Related Questions
Explain the Most Probable Number (MPN)? MPN is a statistical estimating technique which is based on the fact that more the number of bacteria in a sample, more is the dilution

Comparison between Regeneration and Embryonic Development By now you must have realized that the procedures of regeneration and embryonic development have several fundamental

Ancillary Accomodation: Ward KitchenIPantry:  It should have large sink and drain board along with fly proof door. If  the food is received from central kitchen and tray pre

Q. Define Maxillofacial Prosthodontics? Dental implants are now been increasingly used for Maxillofacial Prosthodontics. Maxillofacial Prosthodontics involves the prosthetic re

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

What are vitamins? What are the main vitamins needed by humans? Most vitamins are coenzymes (fundamental substances for the enzyme functioning) that are not formed by the organ

How do we Treat Protein Energy Malnutrition? Major objective of the treatment of PEM is to provide adequate energy and protein intake and control infections, if any. Mild and m

Cell movements are movements performed by cell structures, like the movements of cilia and flagella, the pseudopod movements (in amoeba, macrophages, etc.), the cyclosis of the cyt

Describe about diagnostic approach for congenital heart disease ? In this section we propose to outline the principles of a diagnostic approach that is applicable to newborns,