Study of food texture, Biology

Assignment Help:

Q. Study of food texture?

We learnt earlier that texture is observed in terms of tactile sensations i.e. finger feel and mouth feel. Finger feel is sensed before ingestion, by pressing and touching, e.g. to detect the freshness or staleness of bread by hand feel. On the other hand, once you ingest the food the mixed feeling derived mainly due to the activation of palate and teeth, is the mouth feel. During chewing, various kinds of forces are applied which tell us about the texture of the food. The forces are compression, cutting, tensile strength and shearing.  These same kinds of forces are imitated in the objective evaluation of textural properties.  The term 'mouth feel' can therefore be defined as the mingled experience arising from the sensation of the skin and the mouth during and after ingestion.

You may be wondering why a study of the food texture is important. The study of food texture is important for three reasons:

1. To evaluate the resistance of product against mechanical action such as in mechanical harvesting of fruits and vegetables,

2. To determine the flow properties of a product (what is referred to as rheology) during processing, handling and storage, and

3. To establish the mechanical behaviour of food when consumed.


Related Discussions:- Study of food texture

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How are birds characterized, Q. Bird identity card. How are birds character...

Q. Bird identity card. How are birds characterized according to examples of representing beings, basic morphology, respiration, skin, nitrogen waste, circulation,thermal control an

Combination of meat products, C o mbination of meat products Combinin...

C o mbination of meat products Combining meats and byproducts of different species to produce value added products results in complementation and supplementation of their qua

History of evolution, History of evolution? Evolution is usually define...

History of evolution? Evolution is usually defined as "change over time." In spite of the incredible diversity of life found on Earth, many fundamental characteristics are shar

Global air circulation, Global Air Circulation The major wind systems o...

Global Air Circulation The major wind systems of the earth result because large masses of air around the earth's equator are forced to rise from the bottom due to surface heati

Describe methods of diagnosing chromosome abnormalities, Explain the differ...

Explain the difference between numerical chromosome abnormalities and single gene disorders. Describe methods of diagnosing chromosome abnormalities prenatally and after birth. How

Explain short term complications, Q. Explain Short term complications? ...

Q. Explain Short term complications? Short term complications may arise due to GERD which may in turn increase the frequency or severity of this disease. One of the complicatio

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd