How do populations of predators vary in predatism, Biology

Assignment Help:

How do populations of predators and prey vary in predatism?

Whenever a predator population enhances at the first moment the prey population tends to decrease. At a second moment the decrease of the prey population and the bigger population density of predators cause the predator population to reduce. The prey population then reverts the tendency to reduce and starts to grow.

If variations in the size of populations occur in an unexpected intensity (dissimilar from the usual intensity of the ecological interaction) for example, due to ecological accidents killing much prey, the prey-predator equilibrium is disturbed and both species can be harmed. The existence of the predator sometimes is fundamental for the survival of the prey population, as the absence of predatism favors the proliferation of the prey and, in some cases, when the excessive proliferation creates a population size over the sustenance capacity of the ecosystem, environmental degradation happens and the whole prey population is destroyed.

 


Related Discussions:- How do populations of predators vary in predatism

State the term - neuropsychologists, State the term - neuropsychologists ...

State the term - neuropsychologists Disorders of speech, language, reading, writing, and mathematical abilities are understood in terms of linguistics and the psychology of lan

What are the important organic molecules for living being, What are the mos...

What are the most important organic molecules for living beings? There are many kinds of organic molecules that are significant for the living beings. Especially vital are amin

How a volcanic eruption removes all plant life, A volcanic eruption removes...

A volcanic eruption removes all plant life from a valley below the volcano Explain why succession following the eruption is likely to happen more quickly on the valley floor than o

Define r and k strategists, Define r and K Strategists? Ecologists have...

Define r and K Strategists? Ecologists have identified two major types of reproductive strategies among species. Characteristic patterns can be seen among species relating the

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the meaning of darwins expression, What is the meaning of Darwin's ...

What is the meaning of Darwin's expression "descent with modification"? Descent with modification refers to natural selection. Descent with modification refers to evolutionary chan

Buffalo-pox, Buffalo-pox The disease is caused by an orthopox virus, c...

Buffalo-pox The disease is caused by an orthopox virus, closely related to the vaccinia virus. It is not clear whether it should be considered a separate virus or not. By RE m

Cross-pollination - types of pollination, Cross-Pollination - Types of Poll...

Cross-Pollination - Types of Pollination In this kind of pollination the pollen from anther of one individual is transferred to the stigma of another individual of the same sp

What is an atom referred to in ionic bonds, What is the positive atom refer...

What is the positive atom referred to in ionic bonds and write a monovalent and divalent example.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd