Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Write the meaning of Polyuria?
Increased Urine (Polyuria): When sugar is increased in the blood it is filtered from the body along with the water. This is the reason for frequent and increased urination. It is a very important symptom.
I have 30µg of a primer, whose molecular weight is 600. How much water should I add to get a stock primer concentration of 100µM?
Life S cience is originated from latin word scientia , which means knowledge . Biology is a branch deals with living beings. Biology word is originated from t
Certain conditions such as excessive alcohol consumption can increase the ratio of NADH/NAD+ in the mitochondria. This will directly inhibit which of the following enzymes? -cit
Q. Describe the rationale behind sterilization? Rationale for sterilization: Source of potential infection that exists in dental office include hands, saliva, nasal secretion,
MIDDLE LAMELLA It is thin, amorphous, intercellular matrix between 2 adjacent plant cell. The cells of plant tissue generally cemented together by an intercellular matrix
The chief water conducting elements of xylem in gymnosperms are: 1. Vessels 2. Fibres 3. Transfusion tissue 4. Tracheids Tracheids
Q. What do you mean by Current Impediments? Given the impressive list of past achievements, we expect that quantitative process to biological problems will continue to repay us
Define Economic Evaluation of Malnutrition? You must be familiar with a proverb frequently used in the field of economics, which says - "resources are limited and wants are unl
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
As with food crops, the "discovery, domestication and cultivation" of ornamental plants have a long history. There is indication that lilies were cultivated in China for both medi
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd