Why the enzymatic action is highly specific, Biology

Assignment Help:

Why can it be said that the enzymatic action is highly specific?

The enzymatic action is highly specific because only exact substrates of one enzyme bind to the activation center of that enzyme. every enzyme generally catalyzes only a specific chemical reaction.

 


Related Discussions:- Why the enzymatic action is highly specific

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Regents for estimation of reducing sugar by fehling soxhlet, Define Regents...

Define Regents for Estimation of Reducing Sugar by Fehling Soxhlet Method? Fehling A solution - copper sulphate solution Fehling B solution - alkaline tartarate so

Genetics, The involuntary muscle movement is also genetical sk question #M...

The involuntary muscle movement is also genetical sk question #Minimum 100 words accepted#

How does a population differ from a community, How does a population differ...

How does a population differ from a community? A population having of all members of a single species that live in an area, while a community consists of all organisms of any s

Define typical structures of the seed and define endosperm, What are typica...

What are typical structures of the seed? What is the endosperm? A typical seed is the composed of the embryo, endosperm and shell. Inside seeds of angiosperms there are one or

What are some diseases caused by abnormal gh secretion, What are some disea...

What are some diseases caused by abnormal GH secretion by the hypophysis? In childhood deficient GH secretion might be lead to delayed growth and in severe cases to nanism (dwa

Explain the bioelectrical impedance analysis (bia), Explain the Bioelectric...

Explain the Bioelectrical impedance Analysis (BIA)? The difficulty of measuring total body water (TBW) by Isotope Dilution Method led to the search of Bioelectrical Impedance A

Protoplasmic streaming and tubular peristaltic flow model, Protoplasmic Str...

Protoplasmic Streaming and Tubular Peristaltic Flow Model The first of the above two models involves the well known phenomenon of cytoplasmic streaming in giant algal cells. C

What is root cap, What is root cap? Root cap is a protective structure ...

What is root cap? Root cap is a protective structure located in the tip of the growing root. It defends the meristematic tissue of the root forming a cap that surrounds the tip

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd