What is the major external morphological feature, Biology

Assignment Help:

Q What is the major external morphological feature that differentiates platyhelminthes from other worms (nematodes)?

Platyhelminthes are also recognized as flatworms because they are worms with a flat body. This is the major external morphological feature that differentiates them from nematodes (roundworms).


Related Discussions:- What is the major external morphological feature

What is ribose, What is ribose Browning in canned fish is commonly asso...

What is ribose Browning in canned fish is commonly associated with ribose. Undesirable colour changes in shellfish during canning often involve metal  ions, for example, the bl

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Daily torpor, Normal 0 false false false EN-IN X-NONE...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Define the diet intervention for lactose intolerance, Define the Diet inter...

Define the Diet intervention for lactose intolerance? Lactose is present in dairy products such as milk, cheese, yoghurt, ice cream etc.  Hidden sources of lactose may include

What are cnidocytes, What are cnidocytes? What is the name of the capsule i...

What are cnidocytes? What is the name of the capsule inside the cnidocyte? What are the biological functions of this structure? Cnidocytes are specialized cells present in coel

Elaborate proteins, Elaborate Proteins? Proteins:  Proteins are the p...

Elaborate Proteins? Proteins:  Proteins are the primary constituents of most living cells. Proteins are important components of cell membranes, and they form structures such

Explain in details class hirudenia - leeches, Explain in details Class Hiru...

Explain in details Class Hirudenia - Leeches? This group includes the leeches. Most leeches grow in tropical freshwater habitats, and are familiar to most people as bloodsucker

Why is the occurrence of eyelids in amphibians, Q. Why is the occurrence of...

Q. Why is the occurrence of eyelids in amphibians in comparison to their absence in fishes an adaptation to terrestrial life? Eyelids associated to lacrimal glands protect and

Tissue culture, Tissue Culture It is an important technique for maintai...

Tissue Culture It is an important technique for maintaining a'pm or piece of animal or plant tissue alive after their culture dishes. It is necessary to provide an environment

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd