Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q What is the major external morphological feature that differentiates platyhelminthes from other worms (nematodes)?
Platyhelminthes are also recognized as flatworms because they are worms with a flat body. This is the major external morphological feature that differentiates them from nematodes (roundworms).
What is ribose Browning in canned fish is commonly associated with ribose. Undesirable colour changes in shellfish during canning often involve metal ions, for example, the bl
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Define the Diet intervention for lactose intolerance? Lactose is present in dairy products such as milk, cheese, yoghurt, ice cream etc. Hidden sources of lactose may include
who proposed trinomial nomenclature
What are cnidocytes? What is the name of the capsule inside the cnidocyte? What are the biological functions of this structure? Cnidocytes are specialized cells present in coel
Elaborate Proteins? Proteins: Proteins are the primary constituents of most living cells. Proteins are important components of cell membranes, and they form structures such
Explain in details Class Hirudenia - Leeches? This group includes the leeches. Most leeches grow in tropical freshwater habitats, and are familiar to most people as bloodsucker
Q. Why is the occurrence of eyelids in amphibians in comparison to their absence in fishes an adaptation to terrestrial life? Eyelids associated to lacrimal glands protect and
Tissue Culture It is an important technique for maintaining a'pm or piece of animal or plant tissue alive after their culture dishes. It is necessary to provide an environment
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd