Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Lipid profile control
Evaluation of lipid profile is essential to the management of diabetes and should be performed at initial visit in all patients with diabetes. You have learnt in Unit 2 of this block that LDL is bad cholesterol and HDL is good cholesterol. You have learned the normal values of lipids also. Let us review again:
Q. What are the common contraindications of the contraceptive pills? There are medical reports associating the use of contraceptive pills with vomiting, headaches, vertigo, nau
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
SHARPS : Cuts due to careless handling of sharps such as sectioning razors, microtome blades etc. are probably the most common cause of injury in the biology lab. The only real re
Which of the following statements is true? Answer Viruses are distinct from cells by the absence of a lipid membrane around them. Viruses are parasites that require the cell's meta
Name the location and function of Meibomian glands in the human eye. a) What is cryopreservation? Give its single use. b) Commercial importance of cryopreservation is relate
what are inorganic species
Excretory organ of agama lizard
Explain Components of second heart sounds? The first component of S 2 is due to closure of aortic valve (A,). The second component is due to closure of pulmonary valve (P 2 ).
Explain Hazard Hazard : A biological, chemical or physical agent that is reasonably likely to cause illness or injury in the absence of its control.
What are the target organs upon which insulin and glucagon act? Glucagon mostly acts upon the liver. Insulin acts in general upon all cells. Both also act upon the adipose tiss
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd