What is metabolomics, Biology

Assignment Help:

Together, genomics, proteomics and transcriptomics are influential approaches to enhancing our understanding not only of how cells function normally but also what the key modifications are in disease and so will find enhancing use in the diagnosis of specific diseases and in the identification and assessment of new chemotherapeutic agents. The Metabolomics is perhaps the newest of these fields of study and relates to the study of the little molecule parts of the cell, which is, the metabolome.   By analyzing  the metabolites  of a cell, one can make  a metabolic  profile which indicates  the cell's metabolic  activity; information  that should  show  useful  for a range  of applications,  involving  clinical  diagnostics and  drug  discovery.   .

 

 


Related Discussions:- What is metabolomics

Fat soluble vitamin needs of school children and adolescents, Determine Fat...

Determine Fat Soluble Vitamin Needs of school children and adolescents? ICMR (1990) does not give recommendations for vitamin D, E and K. Vitamin D is very important for skelet

Disorders of thyroid function, Disorders of Thyroid Function: The diso...

Disorders of Thyroid Function: The disorders of thyroid function may  lead to following problems:  Juvenile Hypothyroidism Hypothyroidism is one of the most common end

Lens - organogenesis of eye and limb, Lens - Organogenesis of Eye and Limb ...

Lens - Organogenesis of Eye and Limb There is much experimental proof that the lens formation in many species is dependent on the induction by the optic vesicle while it conta

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Dna double helix , In the year of 1953, Watson and Crick worked out the...

In the year of 1953, Watson and Crick worked out the 3-D structure of DNA, beginning from X-ray diffraction photographs   taken through Wilkins and Franklin. They decreased which D

Adaptation, ADAP T A TIO N - Characters that make an organism to...

ADAP T A TIO N - Characters that make an organism to adjust well and suited to its way of life. Variation occur in living organism due to change in environment. Th

Mode of nutrition, explain the mode of nutrition in paramecium, euglena and...

explain the mode of nutrition in paramecium, euglena and hydra

Law of Minimun, What are the examples of Law of Minimum?

What are the examples of Law of Minimum?

In vivo imaging in psychiatry, In vivo imaging in psychiatry To illustr...

In vivo imaging in psychiatry To illustrate the ingenious applications to which in vivo imaging can be put, consider the use of PET in the study of hallucinations by Frith and

Describe the working of immune system, Q. What is the function of the immun...

Q. What is the function of the immune system? The immune system performs specific defense against agents the antigens that are harmful to the body or foreign. Exogenous anti

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd