Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is Mefloquine
Mefloquine is taken once weekly, but recent reports of serious psychiatric adverse effects have prompted the manufacturer, along with the FDA, to strengthen the drug's contraindications and warnings. It is contraindicated in patients with a history of depression, anxiety, psychosis, schizophrenia or other major psychiatric disorder, seizures, or cardiac conduction abnormalities. Dizziness, headache, insomnia and disturbing dreams are the most common CNS adverse effects. If a patient develops anxiety, depression, restlessness or confusion while taking mefloquine, it should be stopped. Adverse effects of mefloquine in children are similar to those in adults.
Mr. Smith read that cholesterol was bad for his health so he eliminated all foods and food products containing this molecule. He later found that his cholesterol level dropped only
How do the ideas of energy and chemical cycles, community structure, biodiversity and succession fit together to form the basis of the way the natural world works?
Define Nutrition Support in elderly - Parenteral, Enteral and Oral? Under nutrition either due to dietary deficit a due to a medical complication may arise in the elderly. The
Q. Why is the cerebellum more developed in mammals that fly or jump? The cerebellum is the main brain structure that coordinates the movement and the equilibrium of the body. F
The first ever australopithecine fossil was found in 1924 at Taung, South Africa. It was the skull of a 6 year old child showing a mixture of human and ape like features. This a
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Natural Classification Natural classification is based on the natural characters of the taxa. Some consider natural classification a phylogenetic one reflecting the evolutionar
1. One of the greates challenges following the human genome project is to understand how genes are regulated and what functions they perform. a. Define the terms 'Transcriptomic
Which two gases are exchanged when living organisms breathe? Oxygen and carbon dioxide are the gases exchanged when living organisms breathe.
Ask quYour organs are wonderous things, each one with a different function vital to the homeostasis of your body. While it is easy for us to view a particular organ as a single ite
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd