What is mefloquine, Biology

Assignment Help:

What is Mefloquine

Mefloquine is taken once weekly, but recent reports of serious psychiatric adverse effects have prompted the manufacturer, along with the FDA, to strengthen the drug's contraindications and warnings. It is contraindicated in patients with a history of depression, anxiety, psychosis, schizophrenia or other major psychiatric disorder, seizures, or cardiac conduction abnormalities. Dizziness, headache, insomnia and disturbing dreams are the most common CNS adverse effects.  If a patient develops anxiety, depression, restlessness or confusion while taking mefloquine, it should be stopped. Adverse effects of mefloquine in children are similar to those  in adults.

 


Related Discussions:- What is mefloquine

Why did it not drop more give reason, Mr. Smith read that cholesterol was b...

Mr. Smith read that cholesterol was bad for his health so he eliminated all foods and food products containing this molecule. He later found that his cholesterol level dropped only

Intrisic and Extrinsic Limiting Factors, How do the ideas of energy and che...

How do the ideas of energy and chemical cycles, community structure, biodiversity and succession fit together to form the basis of the way the natural world works?

Nutrition support in elderly - parenteral, Define Nutrition Support in elde...

Define Nutrition Support in elderly - Parenteral, Enteral and Oral? Under nutrition either due to dietary deficit a due to a medical complication may arise in the elderly. The

Why cerebellum more developed in mammals that fly or jump, Q. Why is the ce...

Q. Why is the cerebellum more developed in mammals that fly or jump? The cerebellum is the main brain structure that coordinates the movement and the equilibrium of the body. F

Australopithecines, The first ever australopithecine fossil was found in 19...

The first ever australopithecine fossil was found in 1924 at Taung, South Africa. It was the skull of a 6 year old child showing a mixture of human and ape like features. This a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain natural classification, Natural Classification Natural classifi...

Natural Classification Natural classification is based on the natural characters of the taxa. Some consider natural classification a phylogenetic one reflecting the evolutionar

Define the terms transcriptomics and transcriptome, 1. One of the greates c...

1. One of the greates challenges following the human genome project is to understand how genes are regulated and what functions they perform. a. Define the terms 'Transcriptomic

Gases are exchanged when living organisms breathe, Which two gases are exch...

Which two gases are exchanged when living organisms breathe? Oxygen and carbon dioxide are the gases exchanged when living organisms breathe.

Unit 4 Assignment: The Complexity of Human Organs, Ask quYour organs are wo...

Ask quYour organs are wonderous things, each one with a different function vital to the homeostasis of your body. While it is easy for us to view a particular organ as a single ite

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd