Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is Hydrogenqted Fat?
All vanaspati preparations are the result of hydrogenation of oils, where unsaturated fat is converted to saturated fat for its favour and long shelf life. This is often preferred by housewives, as it is an imitation of pure ghee. However it is saturated in nature and contains Tran's fatty acids. Tran's fatty acids, are known to raise LDL in blood thus enhancing atherosclerosis. This is the reason why hydrogenated fats are harmful to the heart.
structure of centrosome and work
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
UTERUS (WOMB) - Large, pyriform, highly elastic. Development of embryo takes place in it. It is located above and behind the urinnary bladder. Attached to body wall by me
Define Reagents - Nelson Somogyi Method for Glucose Estimation? 1. Alkaline copper reagent Alkaline A- Buy commercial from SDS chemicals etc Alkaline B- Weigh 6.25 g anhy
Explain about the Lignans? Lignans are diphenolic compounds formed by dilnerization of 2 cinnamic acid residues. Most lignans apparently pass through the GIT as fibre. Some lig
Q. Patient care plan for hypertensives? - Lifestyle changes: Avoiding smoking, use of tobacco, and excess alcohol intake Physical activity like walking, 4 times a week or 40 mi
The bonding geometry of C,O,N is determined by- Select one: a. The number of electrons in their outer energy level b. SP3 hybridization of orbitals in the valence shell
How does the intensity of simple diffusion differ in relation to the concentration gradient of the moved substance? The higher the concentration gradient of a substance the ext
How do organisms adjust to changes in temperature? Some of the most ordinary way for an organism to adjust to changes in body temperature is by perspiration or panting.
what is ecology?sub divison of ecology?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd