What is cerebellum, Biology

Assignment Help:

What is Cerebellum

Cerebellum is situated under the cerebrum. Cerebellum has right and left lobes which are joined and form a part of pons.

The function of the cerebrum is to:

Help in maintaining muscular coordinates and movements like running, typing etc.

Help to maintain balance.

 


Related Discussions:- What is cerebellum

Changes in the ions, Changes in the Ions The concentration o...

Changes in the Ions The concentration of potassium, phosphate and nitrate declined significantly in the bathing medium within four days. The concentration of so

Transpiration the only way through which leaves lose water, Is the transpir...

Is the transpiration the only way through which leaves lose water? The Plants don't only lose water as vapor as by transpiration. Leaves also lose liquid water by a phenomenon

The graph as temperature increases differ, Does the trend of the change in ...

Does the trend of the change in shape of the graph as temperature increases differ when a different gas is examined?

External events contribute to gain of heat in the body, What (a) internal, ...

What (a) internal, (b) external events contribute to gain of heat in the body?   a) Respiration in the tissues, particularly in the brain and active muscles, is the major in

What is biotic potential, Q. What is biotic potential? The Biotic poten...

Q. What is biotic potential? The Biotic potential is the capability of growth of a given population under hypothetical optimum conditions, i.e., in an environment without limit

Biological fixation - nitrogen fixation, Biological fixation - Nitrogen Fix...

Biological fixation - Nitrogen Fixation Approximately 63% of all nitrogen fixed is through biological fixation. Nitrogen fixing organisms are primarily prokaryotes; bacteria a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Microbiology, 2. Vaccinations against various childhood diseases have contr...

2. Vaccinations against various childhood diseases have contributed to the entry of women, particularly mothers, into the fulltime workplace. a. Is this statement supported by data

Characteristic features of phylum cnidaria, Characteristic features of Phyl...

Characteristic features of Phylum Cnidaria All are aquatic animals. Radial or biradial symmetry around an oro-aboral axis, but no head. Diploblastic, with an epidermi

What is quaternary structure of a protein, Q. What is quaternary structure ...

Q. What is quaternary structure of a protein? Do all proteins have quaternary structure? The quaternary protein structure is the spatial conformation due to interactions among

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd