Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is Cerebellum
Cerebellum is situated under the cerebrum. Cerebellum has right and left lobes which are joined and form a part of pons.
The function of the cerebrum is to:
Help in maintaining muscular coordinates and movements like running, typing etc.
Help to maintain balance.
Changes in the Ions The concentration of potassium, phosphate and nitrate declined significantly in the bathing medium within four days. The concentration of so
Is the transpiration the only way through which leaves lose water? The Plants don't only lose water as vapor as by transpiration. Leaves also lose liquid water by a phenomenon
Does the trend of the change in shape of the graph as temperature increases differ when a different gas is examined?
What (a) internal, (b) external events contribute to gain of heat in the body? a) Respiration in the tissues, particularly in the brain and active muscles, is the major in
Q. What is biotic potential? The Biotic potential is the capability of growth of a given population under hypothetical optimum conditions, i.e., in an environment without limit
Biological fixation - Nitrogen Fixation Approximately 63% of all nitrogen fixed is through biological fixation. Nitrogen fixing organisms are primarily prokaryotes; bacteria a
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
2. Vaccinations against various childhood diseases have contributed to the entry of women, particularly mothers, into the fulltime workplace. a. Is this statement supported by data
Characteristic features of Phylum Cnidaria All are aquatic animals. Radial or biradial symmetry around an oro-aboral axis, but no head. Diploblastic, with an epidermi
Q. What is quaternary structure of a protein? Do all proteins have quaternary structure? The quaternary protein structure is the spatial conformation due to interactions among
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd