What do you understand by taxonomy, Biology

Assignment Help:

Q. What do you understand by taxonomy?

Taxonomy is dependent on many sciences and they in turn are equally dependent on it. The activities of a taxonomist are basic to all other biological sciences because it provides an inventory of flora and fauna, schemes to identification, names and a system of classification of plants and animals. Not only is taxonomy basic to other scientific, fields but also it depends on other disciplines like ecology, plant breeding phytosociology, pharmacology and biochemistry. While dealing with taxonomic problems we have to understand the distribution of plants and animals. The scores of thousands of plants known today as species have been established by the application of the existing and established principles of taxonomy. You should know that the accumulated knowledge of Earth's flora is far from perfect and will become more perfect only by exploration of its areas, collection of its components, their study and classification.

Once names and classification systems have been provided there must be methods for us to identify a taxon as being similar to another known entity. We will discuss keys to the identification of plants and animals in Unit 6. In this unit you will study the ecological and phytosaciological aspects of taxonomy, herbaria, botanic gardens and green house.


Related Discussions:- What do you understand by taxonomy

Explain changes in feeding behaviour of infants, Explain Changes in feeding...

Explain Changes in feeding behaviour of infants? On maturation of neuro-muscular system, the body is able to coordinate sucking, swallowing and breathing. Till about three mont

Structure and content of halsted reitan battery, Structure and Content of ...

Structure and Content of Halsted Reitan battery Although there are several versions of the Halsted Reitan battery, the differences tend to be minor, and there appears to be a

Define nutritional management of severe anorexia nervosa, Define nutritiona...

Define nutritional management of severe anorexia nervosa? The nutritional management of severe anorexia nervosa is therefore, considered in terms of three consecutive phases:

Define energy requirements and dietary energy recommendation, Define Energy...

Define Energy Requirements and Dietary Energy Recommendations? Energy requirement, as you may recall studying earlier, is the amount of food energy needed to balance energy exp

Seismic waves, Earthquake creates seismic waves that travel through and aro...

Earthquake creates seismic waves that travel through and around the surface of the earth. Seismic waves are the waves of energy caused by sudden breaking of rocks during an earthqu

What are the physiological systems, What are the physiological systems know...

What are the physiological systems known as integrative systems? Why is this designation justified? The integrative systems are the nervous system and the endocrine system. The

Explain the central dogma of molecular biology, Which one of the following ...

Which one of the following does not follow the central dogma of molecular biology? 1. Pea 2. Mucor 3. Chlamydomonas 4. HIV HIV is the central dogma of molecular bi

What are the ploidies of the new cells, In which meiotic division does the ...

In which meiotic division does the separation of identical chromatids occur? After the end of this process what are the ploidies of the new cells? The separation of identical c

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Name the molecule that donates hydrogen for photosynthesis, In sulfur photo...

In sulfur photosynthetic bacteria what is the molecule that donates hydrogen for photosynthesis? In sulfur photosynthetic bacteria the substance that donates hydrogen is hydrog

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd