What do you mean by zoonoses, Biology

Assignment Help:

Q. What are zoonoses? What are few examples of zoonoses transmitted by birds?

Zoonoses are human diseases transmitted by animals. Psittacosis, a bacterial disease, cryptococcosis and hystoplasmosis, fungal diseases, are instance of zoonoses transmitted by birds.


Related Discussions:- What do you mean by zoonoses

Determine the organs of the digestive system of earthworms, Which are the c...

Which are the characteristics and organs of the digestive system of earthworms related to the type of diet of these animals? Earthworms eat decomposing organic material and sma

Discuss the role of nadph in erythrocytes, Discuss the role of NADPH in ery...

Discuss the role of NADPH in erythrocytes The fragility of erythrocytes  is impaired in the absence of NADPH generation due to the deficiency of glucose-6-phosphate dehydrogena

Oxidation reduction potential, what exactly is oxidation and reduction pote...

what exactly is oxidation and reduction potential and how its an imp. factor in spoiling meat

Explain the spectrophotometer or colorimeter, Explain the Spectrophotometer...

Explain the Spectrophotometer or Colorimete? These can be used to measure the microbial growth or can be used in various microbial and biochemical assays. Figure illustrates t

Apex locator in retreatment cases-endodontics principles, Apex locator in r...

Apex locator in retreatment cases: -    Electronic apex locators may give misread for working length when gutta-percha is initially being removed. -    Due to that file beging

Chemical properties of fatty acids, Chemical Properties of Fatty Acids ...

Chemical Properties of Fatty Acids Esterification Like any other organic acid,  fatty acids also form esters with  various alcohols. An alcohol such as glycerol is reacted

Predict the outcome of future testing, A hypothesis can be used to predict ...

A hypothesis can be used to predict the outcome of future testing. Which type of hypothesis is easier to test? A. It is easier to specify and test for a difference between two outc

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How campylobacteriosis occurs in humans, How CAMPYLOBACTERIOSIS  occurs in...

How CAMPYLOBACTERIOSIS  occurs in humans C. jejuni frequently contaminates raw chicken. Survey shows that 20-100% of retail chickens are contaminated. Many healthy chickens car

How to investigate mitral stenosis by electrocardiogram, Q. How to Investig...

Q. How to Investigate mitral stenosis by Electrocardiogram? Electrocardiographic changes are not specific for mitral stenosis and are never diagnostic for any valvular heart di

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd