What do you mean by oesophagitis, Biology

Assignment Help:

Q. What do you mean by Oesophagitis?

We already know that oesophagus is a muscular tube 25 cm in length and basically helps in transporting the food from the mouth to stomach, As the bolus of food is moved voluntarily from the mouth to the pharynx, the upper oesophageal sphincter relaxes, the food enters oesopltagus and subsequently the lower oesophageal sphincter (LES) relaxes to receive the food bolus. With the help of peristaltic waves, the bolus of food is moved into the stomach.

Oesophagitis occurs in the lower oesophagus as a result of the irritating effect of acidic gastric reflux on the oesophageal mucosa. It cans an acutelchronic inflammation of the oesophageal wall. It is associated with the common symptom of heartburn (burning epigastric substantial pain). Other symptoms are regurgitation and dysphasia (difficulty in swallowing). Difficulty in swallowing occurs due to pain associated with inflammation of the tissues of the oesophagus. Regurgitation of the acidic gastric contents can be cause or result of oesophagitis.


Related Discussions:- What do you mean by oesophagitis

Excellent identification hypothesis for a plant tissue, What is the most ex...

What is the most excellent identification hypothesis for a plant tissue seen under the microscope having most cells undergoing cell division? The most excellent hypothesis is t

Characteristics of hormones, CHARACTERISTIC S OF HORMONES - (1)      T...

CHARACTERISTIC S OF HORMONES - (1)      They are regulatory chemicals that control and coordinate functions of different body organs. (2)      Hormones are formed by ductle

What are the identical proteins, Q. Are proteins with the same number of ea...

Q. Are proteins with the same number of each dissimilar amino acid that forms them necessarily identical proteins? Even if many proteins have the same number of each different

Define the standard deviation (2 score) classification, Define the Standard...

Define the Standard Deviation (2 score) classification? Statistics teaches us that when normal values of any variable are distributed as per their frequency of occurrence, they

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is law or theory of demand state, What is law or theory of demand stat...

What is law or theory of demand state? The law or theory of demand states as consumers we derive satisfaction or ‘utility’ like a result of consuming a good or a service. It va

Need for insulin in management of type 1 diabetes mellitus, Q. Need for ins...

Q. Need for insulin in management of Type 1 Diabetes Mellitus? Type 1 Diabetes Mellitus occurs when the body's immune system destroys beta cells. Beta cells produce insulin, a

Explain 2nd type of hypersensitivity, It is IgG mediated cytotoxic hyperse...

It is IgG mediated cytotoxic hypersensitivity. Typical manifestations contain erythroblastosis fetalis, hemolytic anemia, blood transfusion reactions etc.

What is ancylostomiasis, What is ancylostomiasis? Ancylostomiasis is a ...

What is ancylostomiasis? Ancylostomiasis is a disease caused by Ancylostoma duodenale or Necator americanus, both hookworms belonging to the nematode phylum (roundworms). Ancyl

Name of the cytoplasm division in the end of mitosis, What is the name of t...

What is the name of the cytoplasm division in the end of mitosis? What are the differences in this process between animal and plant cells? Cytoplasm division happens after telo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd