Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What do you mean by Oesophagitis?
We already know that oesophagus is a muscular tube 25 cm in length and basically helps in transporting the food from the mouth to stomach, As the bolus of food is moved voluntarily from the mouth to the pharynx, the upper oesophageal sphincter relaxes, the food enters oesopltagus and subsequently the lower oesophageal sphincter (LES) relaxes to receive the food bolus. With the help of peristaltic waves, the bolus of food is moved into the stomach.
Oesophagitis occurs in the lower oesophagus as a result of the irritating effect of acidic gastric reflux on the oesophageal mucosa. It cans an acutelchronic inflammation of the oesophageal wall. It is associated with the common symptom of heartburn (burning epigastric substantial pain). Other symptoms are regurgitation and dysphasia (difficulty in swallowing). Difficulty in swallowing occurs due to pain associated with inflammation of the tissues of the oesophagus. Regurgitation of the acidic gastric contents can be cause or result of oesophagitis.
What is the most excellent identification hypothesis for a plant tissue seen under the microscope having most cells undergoing cell division? The most excellent hypothesis is t
CHARACTERISTIC S OF HORMONES - (1) They are regulatory chemicals that control and coordinate functions of different body organs. (2) Hormones are formed by ductle
Q. Are proteins with the same number of each dissimilar amino acid that forms them necessarily identical proteins? Even if many proteins have the same number of each different
Define the Standard Deviation (2 score) classification? Statistics teaches us that when normal values of any variable are distributed as per their frequency of occurrence, they
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is law or theory of demand state? The law or theory of demand states as consumers we derive satisfaction or ‘utility’ like a result of consuming a good or a service. It va
Q. Need for insulin in management of Type 1 Diabetes Mellitus? Type 1 Diabetes Mellitus occurs when the body's immune system destroys beta cells. Beta cells produce insulin, a
It is IgG mediated cytotoxic hypersensitivity. Typical manifestations contain erythroblastosis fetalis, hemolytic anemia, blood transfusion reactions etc.
What is ancylostomiasis? Ancylostomiasis is a disease caused by Ancylostoma duodenale or Necator americanus, both hookworms belonging to the nematode phylum (roundworms). Ancyl
What is the name of the cytoplasm division in the end of mitosis? What are the differences in this process between animal and plant cells? Cytoplasm division happens after telo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd