What do you mean by neurotransmitters, Biology

Assignment Help:

Q. What do you mean by neurotransmitters?

- Nicotinic receptors (nicotine mimics the effects of Ach here). Found at NM-junction, ANS ganglions in general. Binding of Ach to nicotinic receptors is always excitatory (e.g. skeletal muscle contraction).

- Muscarinic receptors occur on all effector cells stimulated by the parasympathetic system. Effect of Ach on muscarinic receptors may be excitatory or inhibitory depending on target organ.

ACh -> (-) heart myocardium, however, ACh -> (+) GI tract smooth muscle

ACh is normally destroyed by ACh-ase, a degradative enzyme found on post-synaptic cells.

Nerve gas is a potent inhibitor of Ach-ase activity -> magnifies cholinergic effects, however, less potent is neostigmine (used in the treatment of myasthenia gravis).

Atropine is a reversible blocker of ACh used in cardiac rescucitation (blocks acetylcholine; so stimulates heart beat). 


Related Discussions:- What do you mean by neurotransmitters

Transport and facilitated diffusion have in common, Q. What do active trans...

Q. What do active transport and facilitated diffusion have in common? What are the dissimilarity between them? Facilitated diffusion can be perplexed with active transport beca

What are heterochromatin and euchromatin, What are heterochromatin and euch...

What are heterochromatin and euchromatin? Chromatin is uncondensed nuclear DNA, the typical DNA morphology in interphase (the phase of the cell cycle in which the cells is not

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is mean by stability study, Stability studies are req. for the product...

Stability studies are req. for the product stable at their desire time as per specification , which give the expiry date and quality as per the manner.

Removal of impurities in water, Many common methods are employed for the re...

Many common methods are employed for the removal of impurities from water. Some of them are: Sedimentation Filtration Reverse osmosis Electro dialysis Aeration

Phylum, morphological characterstics of e histolytica

morphological characterstics of e histolytica

Explain increased fibrinogen levels-thrombogenic factors, Explain Increased...

Explain Increased Fibrinogen Levels and Other Thrombogenic Factors ? Thsombogenesis is an important component in the pathological process of atherosclerosis and so it is not s

What are phospholipids, What are phospholipids? Phospholipids are molec...

What are phospholipids? Phospholipids are molecules made of glycerol bound to two long molecules of fatty acids and to one phosphate group. Thus, phospholipids are amphipathic

Name the large intestine under which there is appendix, Name the sac-like, ...

Name the sac-like, blind pouch of large intestine, situated below the level of junction of the small intestine into the side of large intestine. At the lower portion of this pouch

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd