What do you mean by cold deserts, Biology

Assignment Help:

What do you mean by Cold Deserts?

Cold deserts cover a vast area north of the Himalayan ranges forming an ecosystem with exceptionally low temperatures which may reach - 75°C and a mean annual rainfall of 500-800 mm. They occur in a plateau at 4,500 to 6,000 m and fall within the Trans -Himalayan Biogeographic Zone identified by Rodgers and Panwar (1988) which extends into the Tibetan plateau.


Related Discussions:- What do you mean by cold deserts

Justify the term – flagella, In protozoans flagella are found always one pe...

In protozoans flagella are found always one per cell. Flagella and Cilia can generate substantial force as they try to push or pull a protozoan through water. To be able to do that

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What do you mean by descending aorta, Q. What do you mean by Descending Aor...

Q. What do you mean by Descending Aorta?  The descending aorta begins at the level of the fourth thoracic vertebra. It is defined through the cardiac shadow on the CXR, as it l

Water cycle-hydrological cycle, Water Cycle (Hydrological Cycle) The mo...

Water Cycle (Hydrological Cycle) The movement of water on the earth is continuous and forms many complex inter-related loops (Figure shown below). Cycling of water involves atm

What is specific defence mechanism, What is Specific defence mechanism ...

What is Specific defence mechanism Specific:  These relate to specialized cells located throughout the  body which respond to invasion of foreign materials/microorganisms  su

Explain biotin (vitamin h), Biotin (vitamin H) It was revealed  that eg...

Biotin (vitamin H) It was revealed  that egg yolk could prevent dermatitis and emaciation  in  rats that were kept on  raw  egg white a$ the main protein source. The factor of

Define the elimination of dna ligase activity in a cell, Which of the follo...

Which of the following results from the elimination of DNA ligase activity in a cell? A. The oligonucleotide primers will not be removed from the genome - as they often contain

Monosaccharide derivatives, MONOSACCHARID E DERIVATIVES They are modif...

MONOSACCHARID E DERIVATIVES They are modified monosaccharides. G L YCOSIDES They are compounds formed by condensation reaction between a sugar and hydroxyl group

Explain food lipids, Explain Food lipids It is either consumed in the ...

Explain Food lipids It is either consumed in the form of "visible" fats, which have been separated from the original plant or animal sources, such as vegetable oil and butter,

Eubiont, Eubiont The origin of true life , eubiont from a pmtobiont inv...

Eubiont The origin of true life , eubiont from a pmtobiont involves the acquisition of three major features: 1) assembly of phospholipids and proteins into a cell membrane f

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd