Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What do you mean by Cold Deserts?
Cold deserts cover a vast area north of the Himalayan ranges forming an ecosystem with exceptionally low temperatures which may reach - 75°C and a mean annual rainfall of 500-800 mm. They occur in a plateau at 4,500 to 6,000 m and fall within the Trans -Himalayan Biogeographic Zone identified by Rodgers and Panwar (1988) which extends into the Tibetan plateau.
In protozoans flagella are found always one per cell. Flagella and Cilia can generate substantial force as they try to push or pull a protozoan through water. To be able to do that
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What do you mean by Descending Aorta? The descending aorta begins at the level of the fourth thoracic vertebra. It is defined through the cardiac shadow on the CXR, as it l
Water Cycle (Hydrological Cycle) The movement of water on the earth is continuous and forms many complex inter-related loops (Figure shown below). Cycling of water involves atm
What is Specific defence mechanism Specific: These relate to specialized cells located throughout the body which respond to invasion of foreign materials/microorganisms su
Biotin (vitamin H) It was revealed that egg yolk could prevent dermatitis and emaciation in rats that were kept on raw egg white a$ the main protein source. The factor of
Which of the following results from the elimination of DNA ligase activity in a cell? A. The oligonucleotide primers will not be removed from the genome - as they often contain
MONOSACCHARID E DERIVATIVES They are modified monosaccharides. G L YCOSIDES They are compounds formed by condensation reaction between a sugar and hydroxyl group
Explain Food lipids It is either consumed in the form of "visible" fats, which have been separated from the original plant or animal sources, such as vegetable oil and butter,
Eubiont The origin of true life , eubiont from a pmtobiont involves the acquisition of three major features: 1) assembly of phospholipids and proteins into a cell membrane f
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd